ID: 1032374656

View in Genome Browser
Species Human (GRCh38)
Location 7:131399745-131399767
Sequence ACTACACTGTTAATGAATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032374656_1032374660 -8 Left 1032374656 7:131399745-131399767 CCAATATTCATTAACAGTGTAGT 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1032374660 7:131399760-131399782 AGTGTAGTTTTGAGGAGAAGGGG 0: 1
1: 0
2: 1
3: 23
4: 328
1032374656_1032374662 -6 Left 1032374656 7:131399745-131399767 CCAATATTCATTAACAGTGTAGT 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1032374662 7:131399762-131399784 TGTAGTTTTGAGGAGAAGGGGGG 0: 1
1: 0
2: 1
3: 31
4: 329
1032374656_1032374658 -10 Left 1032374656 7:131399745-131399767 CCAATATTCATTAACAGTGTAGT 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1032374658 7:131399758-131399780 ACAGTGTAGTTTTGAGGAGAAGG 0: 1
1: 0
2: 1
3: 26
4: 254
1032374656_1032374661 -7 Left 1032374656 7:131399745-131399767 CCAATATTCATTAACAGTGTAGT 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1032374661 7:131399761-131399783 GTGTAGTTTTGAGGAGAAGGGGG 0: 1
1: 0
2: 1
3: 32
4: 273
1032374656_1032374659 -9 Left 1032374656 7:131399745-131399767 CCAATATTCATTAACAGTGTAGT 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1032374659 7:131399759-131399781 CAGTGTAGTTTTGAGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032374656 Original CRISPR ACTACACTGTTAATGAATAT TGG (reversed) Intronic
904069779 1:27785449-27785471 ATTTCACTGTTATTGAATTTTGG + Intronic
905110934 1:35594116-35594138 GCTGCACTTTGAATGAATATGGG + Intronic
906086536 1:43139932-43139954 ATTACACTGTCATTGAATATTGG + Intergenic
906376703 1:45302467-45302489 GCTACAATGTTAATCAATAGGGG + Intronic
907676851 1:56525844-56525866 CCTCCACTGTAAAAGAATATTGG - Intronic
909428584 1:75557702-75557724 ACTACAGTGTAAATGTGTATAGG - Intronic
909857595 1:80558495-80558517 ACAGCACTATTAATGAATCTTGG - Intergenic
910166713 1:84336215-84336237 ACAAAACTGTTAAGAAATATGGG - Intronic
912039620 1:105371868-105371890 ACTAAACTGTTAAGGTAAATTGG + Intergenic
916001692 1:160622782-160622804 AATACACTGATAAAGAATGTGGG - Intronic
918369508 1:183845494-183845516 ATGAAACTGTAAATGAATATTGG - Intronic
923941214 1:238829549-238829571 CCTACAGTGTGAATGGATATAGG - Intergenic
924160497 1:241226879-241226901 ACTACATTGTAATTGAAAATAGG + Intronic
1063852730 10:10211389-10211411 ACTAAACTTCTATTGAATATTGG - Intergenic
1064254066 10:13729209-13729231 CCTACACTGTGAATGAGTAAGGG + Intronic
1065337378 10:24667195-24667217 CCTATACTGTTATTGAAGATGGG - Intronic
1066147251 10:32573898-32573920 ACTAGACTGTTAATGCATTGAGG - Intronic
1067938126 10:50628398-50628420 ACAAGAGGGTTAATGAATATAGG - Intergenic
1070287895 10:75097013-75097035 ACTACACTGTTTAGATATATAGG + Intronic
1071741819 10:88367462-88367484 ATTCCACTGTTGATGAACATAGG + Intronic
1076141680 10:128084392-128084414 CACACACTGTTAATGAATAGGGG - Exonic
1078985214 11:16587678-16587700 ACTAAGTTGTTAATGAAAATAGG + Intronic
1080376230 11:31715912-31715934 ATTACACAGTTAAGGGATATAGG + Intronic
1080515767 11:33018178-33018200 ACAACACTTTTACTGGATATTGG - Intronic
1081050477 11:38333690-38333712 ACTATATTTTTACTGAATATTGG + Intergenic
1082773439 11:57227416-57227438 ACTTCACTGGTAAAGAAAATGGG - Intergenic
1089089509 11:115858172-115858194 ACTACACTGTTAAATAAAAGTGG - Intergenic
1096320232 12:50605579-50605601 AATTGACTGCTAATGAATATGGG - Intronic
1103585016 12:121946288-121946310 AATTCACTGTTAATGGACATTGG + Intronic
1105726475 13:23167300-23167322 ATTAATCTGTTGATGAATATAGG + Intergenic
1108070770 13:46626253-46626275 ATTACACTATTAATGACTATGGG + Intronic
1109358124 13:61259499-61259521 ACTCCACTTTTAAAAAATATTGG + Intergenic
1111128120 13:83938574-83938596 ACTAAACAGTTAAAGAAAATAGG + Intergenic
1111448305 13:88379748-88379770 AATACACTTTTTATGAATAAGGG - Intergenic
1112978655 13:105353730-105353752 ACTAAACTGTGTTTGAATATTGG - Intergenic
1117834091 14:59783832-59783854 ACTACACTTTTAATTCATACAGG - Intronic
1118789613 14:69078011-69078033 ATTACACTGTGAAGGAATGTTGG + Intronic
1118971107 14:70639194-70639216 ATTACACTGCTAATGAGTAGTGG - Intergenic
1120469212 14:84901767-84901789 AATAAACTGTTAGTGAATACGGG - Intergenic
1120473824 14:84961475-84961497 TCTCCACTCTTAATGAATTTAGG - Intergenic
1121459057 14:94059870-94059892 ACTTCAATACTAATGAATATAGG - Intronic
1126668823 15:51097490-51097512 AATATACTATGAATGAATATAGG - Intronic
1131896950 15:97043862-97043884 AGGAAACTGTTAATGAAGATGGG + Intergenic
1135417468 16:22279692-22279714 ACTGCTCTCTTAATAAATATTGG + Intronic
1135579490 16:23613226-23613248 TCTACTCTGCTACTGAATATTGG + Intronic
1139048433 16:63092259-63092281 ACTACACATTTAAAAAATATCGG + Intergenic
1141872353 16:86796152-86796174 AATACACAGTTAATGAAAAAAGG - Intergenic
1150418911 17:65012353-65012375 ATTGCAGTGCTAATGAATATCGG - Exonic
1159369076 18:67508614-67508636 GTTACACTGAGAATGAATATGGG - Exonic
1162274749 19:9644112-9644134 ATTATATTGGTAATGAATATTGG - Intronic
1165348596 19:35264614-35264636 ACTTCACTGTTCATGTATCTTGG - Intronic
925709982 2:6729516-6729538 ACTTCGCTGTTAAAGAAAATTGG - Intergenic
926348789 2:11975992-11976014 ATTACACTGTTAATGAGCAGTGG + Intergenic
930603408 2:53467795-53467817 AGTAGATTGTTAATGAATGTTGG + Intergenic
935400950 2:102659680-102659702 ACTACTCAGTTCATGAATAATGG - Intronic
936749552 2:115624852-115624874 ACAAAACACTTAATGAATATAGG + Intronic
936937831 2:117855242-117855264 ACTACTCTATAAAGGAATATGGG - Intergenic
938641525 2:133285834-133285856 ATTTCAATGTTAAGGAATATTGG - Intronic
938815985 2:134904614-134904636 ACAAAGCTGTTAATGTATATGGG - Intergenic
940568382 2:155398575-155398597 ATTACACTGTTAAAAATTATTGG + Intergenic
941204023 2:162548962-162548984 ACTCCCCAGTTAATCAATATTGG - Intronic
942883228 2:180888952-180888974 TCTACTCTGCTATTGAATATTGG - Intergenic
943793367 2:191960895-191960917 TGTAGACTGTTAATGTATATCGG + Intronic
947835893 2:233175289-233175311 ACTCTACTGTTAATGGACATAGG - Intronic
1169602808 20:7281197-7281219 ACAAGACTTTTATTGAATATGGG - Intergenic
1169674908 20:8142501-8142523 ACTACACTGCAATTCAATATTGG + Intronic
1172926340 20:38539831-38539853 ACTACACTGATAAACAATGTAGG - Exonic
1173369035 20:42418538-42418560 ACCACACATTTAATGATTATTGG - Intronic
1173493569 20:43502934-43502956 CCTACACTGTGAATGGATTTGGG - Intergenic
1177105842 21:16954449-16954471 AATAAACTGTGAATGAATGTTGG - Intergenic
949992978 3:9594446-9594468 AGTAGACTGCTAATGGATATGGG + Intergenic
950975743 3:17242036-17242058 GCTACGCTGTGAATGAAAATAGG + Intronic
952621473 3:35348372-35348394 ACTACAATGTTAAGGAATAGTGG - Intergenic
953619996 3:44524928-44524950 ATTGCACTGATAATGAATAAAGG + Intergenic
959529763 3:107420625-107420647 TCAACACTGTTAATGTTTATTGG + Intergenic
959791665 3:110368935-110368957 ACTACACTTATAATGAAAAGAGG - Intergenic
959989875 3:112619114-112619136 AATAAAATGTGAATGAATATGGG + Intronic
960816855 3:121682623-121682645 ACTAAGCTTTTAATGAGTATTGG - Intronic
960913533 3:122674333-122674355 ACTACACTGGGTATGAATACAGG - Intergenic
961462173 3:127057858-127057880 ACTCTACTGTTAATGAACATTGG - Intergenic
962537788 3:136346097-136346119 ACCAAACTTTTAATGAATACAGG - Intronic
969078003 4:4595721-4595743 ACTACACAGGGCATGAATATTGG + Intergenic
970101850 4:12532267-12532289 ACTTCACTGTTAATGGAAAGGGG - Intergenic
970987345 4:22173898-22173920 AGTAGACTGTAAGTGAATATTGG - Intergenic
971274869 4:25186214-25186236 TCTACACTTTATATGAATATGGG + Intronic
972900530 4:43676575-43676597 ACTACACTATTAAAGAAAAATGG - Intergenic
975425452 4:74220496-74220518 ATTATATTTTTAATGAATATAGG + Intronic
977871279 4:102093526-102093548 ACCACACTGTTATTGTATGTTGG - Intergenic
979460194 4:120973649-120973671 AGGACACTGTTAGTGACTATAGG - Intergenic
986407874 5:7444550-7444572 ACTCCAATGTCAATCAATATTGG - Intronic
987491654 5:18587796-18587818 ATTACTATGTTAAAGAATATAGG - Intergenic
988696956 5:33631570-33631592 ACTCCATTGTGAATGAAGATAGG + Intronic
989663211 5:43822154-43822176 CCTACTCTGCTATTGAATATTGG + Intergenic
990937986 5:61171009-61171031 GTTGTACTGTTAATGAATATAGG + Intergenic
993192261 5:84697089-84697111 ACCACAGTGTTAATGAGTTTGGG + Intergenic
993745824 5:91595923-91595945 ATTCCAATGTTAATGAATGTAGG + Intergenic
993859027 5:93111959-93111981 ACTGCACTTTTACTGAATGTTGG - Intergenic
996512798 5:124336186-124336208 ACTACAAAGTTAATGAGCATAGG - Intergenic
998210266 5:140191709-140191731 ACTACAGTTTTAATGAAGTTAGG + Intronic
1012122840 6:95388556-95388578 AGTACACTGTTTATGAAGAAAGG + Intergenic
1013830094 6:114261652-114261674 ACTATACTGTAAATGGATTTGGG - Intronic
1014930514 6:127330514-127330536 ATTAAACAGTTAATGAATTTCGG + Intronic
1015756752 6:136615051-136615073 ACAACACTTTTGATGATTATTGG + Intronic
1016201318 6:141413047-141413069 ATTCTTCTGTTAATGAATATTGG + Intergenic
1016369731 6:143361224-143361246 ATTACATTGTTAATGCCTATAGG - Intergenic
1016503475 6:144749241-144749263 ACTACACTGTCAATGAGATTTGG - Intronic
1016702418 6:147068494-147068516 ACTAGACCATCAATGAATATCGG - Intergenic
1018167182 6:161109179-161109201 AGTACACTGTTAAGTAATACTGG + Intronic
1018405379 6:163476162-163476184 AAAACACTGATAATAAATATTGG + Intronic
1020389679 7:7644726-7644748 GCTACACTATTAAAGAAAATAGG - Intronic
1020847356 7:13303933-13303955 ACTACACCTTTAATGCATGTTGG + Intergenic
1021017767 7:15556362-15556384 ACTGCACTTTTAATACATATGGG - Intronic
1021103276 7:16608074-16608096 CCTACACAGCTAAGGAATATTGG + Intronic
1022615213 7:31922883-31922905 ACAACACAGTTTATGACTATTGG + Intronic
1024500953 7:50105340-50105362 CCTTTACTGCTAATGAATATGGG - Intronic
1027589968 7:80106169-80106191 ACAACATTGGTAATGATTATAGG - Intergenic
1027998586 7:85461314-85461336 ACTCCATTGAAAATGAATATGGG + Intergenic
1028382798 7:90217301-90217323 AGTACATTGTTACTGACTATAGG + Intronic
1029869208 7:103671389-103671411 ACAACACTAATAAAGAATATTGG + Intronic
1031086463 7:117306214-117306236 ACTACAATTTTAATGAAGTTTGG + Intronic
1031692133 7:124801935-124801957 TCTACATTTTTAATGAATATGGG + Intergenic
1031815969 7:126435978-126436000 TCTACACTGTCAAGAAATATTGG + Intergenic
1032374656 7:131399745-131399767 ACTACACTGTTAATGAATATTGG - Intronic
1035857180 8:2988146-2988168 ACTAAAGTGTTAATGAAAAATGG - Intronic
1035887996 8:3312988-3313010 TCAACACTGTTTTTGAATATTGG + Intronic
1037362674 8:18090408-18090430 ACTACTCTGTTATTGAATCTTGG + Intergenic
1041596688 8:59662983-59663005 ACTACACTATCAATGACAATAGG + Intergenic
1041722714 8:60990686-60990708 AAAACCCTGTTAATTAATATAGG - Intergenic
1043420470 8:80092522-80092544 ATTCAACTATTAATGAATATAGG - Intronic
1043636839 8:82395095-82395117 ATTAAACTGTTAATGAATCTTGG - Intergenic
1044518562 8:93169328-93169350 AATACACTGTTGATGAATATTGG + Intergenic
1045820393 8:106329957-106329979 ACTAAACTTTAAATGAATGTTGG + Intronic
1046209413 8:111048088-111048110 TCTACTCTGCTATTGAATATTGG - Intergenic
1046449676 8:114371829-114371851 ACTAAACAGATGATGAATATTGG - Intergenic
1046637270 8:116683906-116683928 AGTAAACTGTGAATAAATATGGG - Intronic
1047551768 8:125881365-125881387 ACTCCATTCTTAATGAATCTAGG - Intergenic
1047689506 8:127337203-127337225 ACTAGGCAGTTAATCAATATTGG - Intergenic
1051709315 9:19914006-19914028 ACTACCCAGTTAATCAAGATTGG - Intergenic
1052639752 9:31151787-31151809 AGTACAATGTTAAAGAAGATTGG - Intergenic
1055254549 9:74352283-74352305 ACTTGACAGTTAATGAGTATTGG - Intergenic
1059980114 9:119762265-119762287 ACTAAACTGAAAGTGAATATGGG + Intergenic
1186320076 X:8414526-8414548 ACTACACTGTTATACACTATTGG + Intergenic
1190805549 X:53832888-53832910 CCTACTCTGTTATTGAACATTGG + Intergenic
1191672945 X:63765820-63765842 ACTATACTGTTAATGGAGAAGGG + Intronic
1193953391 X:87827809-87827831 CCTACTCTGCTATTGAATATTGG + Intergenic
1194463568 X:94203468-94203490 ACTACACTAATGATGAGTATGGG - Intergenic
1196866857 X:120078320-120078342 GATACACTGTTACTGAATCTAGG - Intergenic
1196876242 X:120157962-120157984 GATACACTGTTACTGAATCTAGG + Intergenic
1198913879 X:141644555-141644577 AATAGACTGTTAATTACTATTGG - Intronic