ID: 1032374659 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:131399759-131399781 |
| Sequence | CAGTGTAGTTTTGAGGAGAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1032374656_1032374659 | -9 | Left | 1032374656 | 7:131399745-131399767 | CCAATATTCATTAACAGTGTAGT | 0: 1 1: 0 2: 1 3: 7 4: 140 |
||
| Right | 1032374659 | 7:131399759-131399781 | CAGTGTAGTTTTGAGGAGAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1032374659 | Original CRISPR | CAGTGTAGTTTTGAGGAGAA GGG | Intronic | ||
| No off target data available for this crispr | |||||