ID: 1032374659

View in Genome Browser
Species Human (GRCh38)
Location 7:131399759-131399781
Sequence CAGTGTAGTTTTGAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032374656_1032374659 -9 Left 1032374656 7:131399745-131399767 CCAATATTCATTAACAGTGTAGT 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1032374659 7:131399759-131399781 CAGTGTAGTTTTGAGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032374659 Original CRISPR CAGTGTAGTTTTGAGGAGAA GGG Intronic
No off target data available for this crispr