ID: 1032376456

View in Genome Browser
Species Human (GRCh38)
Location 7:131423995-131424017
Sequence GCTGGGTCATGATACTTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032376456 Original CRISPR GCTGGGTCATGATACTTCAA GGG Intronic
908016906 1:59850658-59850680 ACTTGGCCATGATACTTTAATGG + Intronic
911126296 1:94343932-94343954 TGTGGGTCAGGATACTTCCAAGG - Intergenic
917327866 1:173851589-173851611 GCTGAGTCATGATTCTTCAGGGG + Intronic
917545385 1:175961454-175961476 GCTGGGTCCTGGAATTTCAAAGG + Intronic
920194349 1:204216996-204217018 GCAGGGTCATGAGACTGCCATGG - Intergenic
921072265 1:211670985-211671007 GCTGGGTCTTGACTGTTCAAGGG - Intronic
924141092 1:241024160-241024182 TCTGAATCATCATACTTCAAAGG + Intronic
1063709062 10:8459385-8459407 GCTGGGCCCTGAGGCTTCAATGG + Intergenic
1064225290 10:13478230-13478252 CCTGGTTCATGACACTTCCAGGG + Intronic
1068846025 10:61675341-61675363 GCTCGGTCATTGTACTCCAAAGG - Intronic
1070639865 10:78160393-78160415 GCTGGGTCATGTGACTGCACTGG + Intergenic
1070823348 10:79375913-79375935 GCTGAGTCATGATCCATCTAGGG - Intergenic
1070840558 10:79484521-79484543 GCTGGGTCATGAAAAATCAACGG + Intergenic
1071914352 10:90274876-90274898 GCAAGGTCATGTTACTACAAAGG - Intergenic
1078182198 11:9021257-9021279 ACTGGGTCATTATAGTTCCATGG - Intronic
1085243330 11:75076420-75076442 GCTGGGTGATAATATCTCAAAGG - Intergenic
1085344551 11:75759713-75759735 GCTGGGTCATGAAACTGAATAGG - Intronic
1091007997 11:131971093-131971115 GCTGGGTCATGGGACTCCACAGG + Intronic
1091448766 12:559912-559934 GCCGGGTCATGAGACACCAAGGG + Intronic
1091522887 12:1265694-1265716 GGTGGGGCATGATACTTTAAGGG - Intronic
1092950739 12:13500666-13500688 GCAGGGCCATGCTCCTTCAAGGG - Intergenic
1093890239 12:24511180-24511202 TCTGGTTCATGTGACTTCAAGGG - Intergenic
1094512029 12:31102722-31102744 ACTGGGTCCTGATACAGCAATGG - Intronic
1096010337 12:48208547-48208569 GCTGTGTCATGTTGCTGCAAAGG - Intergenic
1097470195 12:59980961-59980983 ACTGGGTCAAGACACTGCAATGG + Intergenic
1099945231 12:89236285-89236307 GCTGGTTCATGATGTTTCATTGG - Intergenic
1107307868 13:39042197-39042219 GCTGGGTTATCAAACTGCAAAGG - Exonic
1109809244 13:67489299-67489321 GCTGGTTGATGATTCTACAATGG + Intergenic
1111427123 13:88100923-88100945 GCTCGGTCATGTTACTTGATTGG + Intergenic
1113222008 13:108115544-108115566 ACTGGGTCATGAGTTTTCAAAGG + Intergenic
1115610617 14:35046008-35046030 GCTGTGTCGTTGTACTTCAAAGG - Intronic
1130381341 15:83374930-83374952 GCTGGGTCCTGATGATGCAATGG + Intergenic
1130819447 15:87479017-87479039 CCTGGGTCATGATTCTGCAAAGG - Intergenic
1143136963 17:4717495-4717517 GCTTGGTCATGGTAGTGCAAGGG - Intronic
1149412571 17:56423836-56423858 GCTGGGCTATGATAATTCTAGGG + Intronic
1154087928 18:11325397-11325419 GCTGACTCATGCTAGTTCAATGG + Intergenic
1156133478 18:34006843-34006865 GCTGGGGCAAGGTTCTTCAAAGG + Intronic
1158303202 18:56075832-56075854 GGTGGGTTATGATACATAAAAGG + Intergenic
1159452134 18:68616098-68616120 GCTGGGACAAGATCCTTCATGGG + Intergenic
1161958315 19:7508278-7508300 GCTGGGCCCTGGTACTTGAAAGG - Exonic
1168313336 19:55472695-55472717 GCTTGGCCATGAGACTTCAGAGG + Intergenic
926488302 2:13491265-13491287 GCTGGGTCATGAAACTGGAAAGG - Intergenic
945530018 2:210941534-210941556 AATGTGCCATGATACTTCAATGG + Intergenic
947186131 2:227457183-227457205 GCTGCATCATGACAGTTCAAAGG - Intergenic
1175334238 20:58184750-58184772 GCTGGGTCCTGAATGTTCAAGGG + Intergenic
1175334671 20:58187455-58187477 GTTGGGTCATGAAAGGTCAATGG - Intergenic
1179956485 21:44742282-44742304 GCTGGGTAATGAGATTTAAAAGG + Intergenic
1182342946 22:29639092-29639114 ACTGGATCATGATGTTTCAAAGG + Exonic
1182923712 22:34103371-34103393 CCTGGGTCATGACAGTTGAAAGG + Intergenic
949142298 3:649447-649469 CCTTGTTTATGATACTTCAAAGG - Intergenic
952140463 3:30473226-30473248 GCTGGGTCATGTTACATGTACGG + Intergenic
954043708 3:47910816-47910838 GCTGCCTCATGATCCTTCCATGG + Intronic
957565039 3:81874743-81874765 TCTGGCTCATAATACCTCAAGGG - Intergenic
959699317 3:109283393-109283415 GCTGGGTCATGAAACTTATGTGG + Intergenic
964783997 3:160373521-160373543 GGTGGTTCAGGATAATTCAAGGG + Intronic
964869742 3:161300495-161300517 GCATGGTCATGATACTCCAGTGG - Intergenic
965553794 3:169998956-169998978 TCTAGCTCATGATACTTCTATGG - Intergenic
966578794 3:181535788-181535810 GCTGGTTCATGCTACCTCAGCGG - Intergenic
967921510 3:194617566-194617588 GCTGAGTCATGATCAATCAAAGG - Intronic
971633866 4:29031561-29031583 GCTGGGTGAAGAGACTGCAAAGG + Intergenic
988422850 5:31027390-31027412 GCTTGGGCATGCTACTTGAAAGG - Intergenic
994940756 5:106320925-106320947 TCTGGGTCATGATAGTTCAAAGG + Intergenic
998333836 5:141352588-141352610 GCTGTGTGATGATCCTTCTATGG + Exonic
1011030671 6:82919302-82919324 GCCAGGTCCTGATACTTCTAAGG - Intronic
1014129248 6:117811783-117811805 GCAGGCTCATGATTCTTAAAGGG + Intergenic
1016393197 6:143595429-143595451 CCTGGGTCATGAGAATTCTATGG + Intronic
1021634816 7:22681890-22681912 TCTGAGTCATAATACTTCAGTGG - Intergenic
1026359060 7:69586030-69586052 GCTGGGGAATTATAGTTCAAGGG - Intergenic
1032376456 7:131423995-131424017 GCTGGGTCATGATACTTCAAGGG + Intronic
1033852343 7:145512896-145512918 GCATGGTCATGAAGCTTCAATGG - Intergenic
1039340909 8:36648880-36648902 TCTGGGTGATGATACTTAGATGG + Intergenic
1041527502 8:58823674-58823696 ACTGTTTCATGATACTTGAAAGG - Intronic
1047269301 8:123340182-123340204 GCCTGGTCCTGATACTTAAAAGG + Intronic
1057691483 9:97290627-97290649 GCCGGGTTATGGAACTTCAAAGG - Intergenic
1057823668 9:98354596-98354618 GCTGGTTCATGAGATTTAAAAGG - Intronic
1059316879 9:113433304-113433326 GCTGGTTTATTATACTACAAAGG + Intergenic
1189291135 X:39886873-39886895 GCTGGGTAATGAGGCTACAAAGG - Intergenic
1194023660 X:88724638-88724660 GCTTGTTCATGATAGGTCAATGG - Intergenic
1197940571 X:131784377-131784399 CCTGGGTCATTAAACTGCAATGG + Intergenic