ID: 1032381617

View in Genome Browser
Species Human (GRCh38)
Location 7:131489680-131489702
Sequence CTGTAAAAATAAATGGTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 381}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032381617_1032381621 19 Left 1032381617 7:131489680-131489702 CCCTCCACCATTTATTTTTACAG 0: 1
1: 0
2: 3
3: 45
4: 381
Right 1032381621 7:131489722-131489744 TCAGTTCCTTAAATGTTATTTGG 0: 1
1: 0
2: 0
3: 25
4: 315
1032381617_1032381622 22 Left 1032381617 7:131489680-131489702 CCCTCCACCATTTATTTTTACAG 0: 1
1: 0
2: 3
3: 45
4: 381
Right 1032381622 7:131489725-131489747 GTTCCTTAAATGTTATTTGGAGG 0: 1
1: 0
2: 3
3: 25
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032381617 Original CRISPR CTGTAAAAATAAATGGTGGA GGG (reversed) Exonic
905365125 1:37447181-37447203 CTGTACAGATAAATGGTCGGGGG + Intergenic
906025209 1:42667642-42667664 CTGTAAAAATAAAAAGAGAAAGG + Intronic
906586185 1:46980890-46980912 ATTTAAAAATAAATGGTGCTGGG + Intergenic
909122618 1:71623339-71623361 ATGTCAAAATAAATGGCGGGGGG - Intronic
909181980 1:72435873-72435895 CTGAAAGAATAAATGCTTGAAGG - Intergenic
909938864 1:81587810-81587832 CTGTGAAAATAAATTAAGGAGGG + Intronic
910099056 1:83557064-83557086 ATGCAAAAATATGTGGTGGATGG - Intergenic
911936645 1:103984409-103984431 CTGTAAAAAAAAATTGTTGGGGG + Intergenic
912341286 1:108918321-108918343 CTGTAAAAATAAAATATGAATGG - Intronic
912824951 1:112896911-112896933 CTGTAAAAATAATGGCTTGATGG - Intergenic
913568259 1:120095053-120095075 TTGTGAGAATGAATGGTGGAGGG - Intergenic
918688256 1:187446603-187446625 TTCTGAAAATAAATGGTGGAGGG - Intergenic
919066281 1:192695959-192695981 CTGTTAAAATAAAAGGTGTGAGG - Intergenic
920493023 1:206433164-206433186 CTGCAAAAAGAAATGCAGGAAGG + Intronic
923348291 1:233079226-233079248 CTCTAAAACTAAAAGGTGGCCGG + Intronic
1063757821 10:9035382-9035404 TTGTCAAAATAAATGGAGGGAGG + Intergenic
1064668517 10:17683607-17683629 ATGTAAAATTAAAAAGTGGATGG - Intronic
1065710577 10:28513213-28513235 CTGTGAGAAGATATGGTGGAAGG - Intergenic
1065746970 10:28851139-28851161 ATGTAAAGATAAATGGTGACTGG + Intronic
1066050315 10:31628675-31628697 GTTTCAAAATAATTGGTGGAGGG + Intergenic
1067510289 10:46889121-46889143 CTGTGAAAATGAATGTTGCAGGG - Intergenic
1067651966 10:48162736-48162758 CTGTGAAAATGAATGTTGCAGGG + Intronic
1068048628 10:51919668-51919690 CTTTAAAAAAAAAAGGTGGGGGG - Intronic
1068232652 10:54190819-54190841 TTATAAAAATAAATGGTGCTCGG + Intronic
1068781051 10:60919576-60919598 CTGTTGATTTAAATGGTGGAAGG - Intronic
1069562572 10:69441226-69441248 CTATAAAAGAACATGGTGGAAGG - Intergenic
1072254065 10:93603764-93603786 CTTTAAAAATAAATGTTTTATGG - Intronic
1073173565 10:101534567-101534589 CTCTAAATATAAGGGGTGGAAGG + Intronic
1073198408 10:101714597-101714619 CTTTTCAAATAAATGGTGGTGGG - Intergenic
1074046642 10:109845448-109845470 CTTTAAAAATAACTTGTGGAGGG + Intergenic
1074580577 10:114715304-114715326 TTGTAAAAATTAATGGTGTTTGG - Intergenic
1075643394 10:124081695-124081717 CTGGAAACATAAACGCTGGAAGG + Intronic
1077587404 11:3464169-3464191 CTATAAAGATTACTGGTGGAGGG - Intergenic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1078484494 11:11708929-11708951 CTTTAAAAATAAATGGATGAGGG - Intergenic
1079075549 11:17383406-17383428 CTGTAATCTTACATGGTGGAAGG - Intergenic
1079091589 11:17484348-17484370 CTGTAAACTTACATGGTGGAAGG - Intergenic
1080584895 11:33672745-33672767 CTGTATCAATAACTGGTGGTGGG - Exonic
1080610147 11:33896910-33896932 CTGTAAATCTACATGGTAGAAGG - Intergenic
1083087046 11:60159998-60160020 CTGGAAAAAAAAATGTTGGGGGG + Intergenic
1084600832 11:70144578-70144600 CTGTGAAAATCAATGTGGGAAGG + Intronic
1084705134 11:70811703-70811725 ATGGATAAATGAATGGTGGATGG - Intronic
1084829587 11:71758771-71758793 CTATAAAGATTACTGGTGGAGGG + Intergenic
1085164970 11:74390644-74390666 ATGTAAAAAGAACTGGAGGAAGG + Intronic
1085652275 11:78278980-78279002 CAGTAAAAAAAAGTGGTAGAGGG - Intronic
1086042776 11:82498936-82498958 CTATAGAAATAAAAAGTGGAAGG + Intergenic
1089445216 11:118546483-118546505 CTGTAAAAAAAAAGGAAGGAAGG + Intronic
1090111867 11:123920377-123920399 CTACAAAAATAAATGTTGTATGG + Intergenic
1091577099 12:1748106-1748128 ATTTAAAAATAAAGGGTGGGGGG - Intronic
1091854773 12:3730778-3730800 CTGCAAAAAGAAATCCTGGAAGG + Intronic
1092413651 12:8272921-8272943 CTATAAAGATTACTGGTGGAGGG - Intergenic
1093086829 12:14875139-14875161 CTGTAGAAAGAAATAGTGGGAGG + Intronic
1094708047 12:32933911-32933933 CTATATAAATAAATGATGTATGG + Intergenic
1095101688 12:38191363-38191385 CTATAAAAATAATTGGTGGCTGG - Intergenic
1096342112 12:50809641-50809663 CTGTAGAAAGAAATGGTGTTAGG + Intronic
1097937483 12:65270207-65270229 ATGAAAAAATAAGTGGTTGATGG + Intergenic
1098394237 12:70001698-70001720 CTGAAAAACAAAATGGTGAAGGG - Intergenic
1098787962 12:74783367-74783389 AATTAAAAATAAATAGTGGAAGG + Intergenic
1099639202 12:85263002-85263024 CTGTACAACTCAGTGGTGGATGG + Intronic
1099739280 12:86610801-86610823 CTGTAAAAGTAAATGAGAGACGG + Intronic
1100555642 12:95690910-95690932 CTTTTAAAATATATGGTAGAAGG - Intronic
1100664396 12:96735512-96735534 CTGTAAAAATGACTGGTGGTGGG + Intronic
1100986261 12:100204133-100204155 CTTTAAAAAAAAATGGGGGAGGG + Intronic
1101609812 12:106280183-106280205 CTTTAAAAATAAATGGGGTAAGG + Intronic
1102741717 12:115213522-115213544 CTGCAAAGAAAAATAGTGGAAGG - Intergenic
1103006201 12:117422360-117422382 ATGTATGAATAGATGGTGGATGG - Intronic
1104263381 12:127206145-127206167 CTTTATAAAAACATGGTGGAGGG - Intergenic
1104378284 12:128284586-128284608 CTGTAAGAAATAATGGTGAAAGG + Intronic
1106193820 13:27476456-27476478 GTGAAAGAATAAATGTTGGAAGG + Intergenic
1106961912 13:35008924-35008946 CTGTAAAAACAACAGTTGGAGGG - Intronic
1106968652 13:35106761-35106783 CTTTAAAAAAAAAAGGCGGAGGG - Intronic
1107578932 13:41760946-41760968 CTTTAAAAATAAATTTTGCATGG + Intronic
1107854724 13:44603490-44603512 CTATAAAAATAAATTGAGGCCGG + Intergenic
1108148817 13:47509170-47509192 CTTTAAAAATAAATGGTTTTTGG - Intergenic
1108877709 13:55068106-55068128 ACATATAAATAAATGGTGGAGGG - Intergenic
1108907336 13:55494414-55494436 CAGTAAAAACAAGTGGTGCATGG - Intergenic
1109161384 13:58979125-58979147 ATTTAAAAAATAATGGTGGATGG + Intergenic
1110049004 13:70871067-70871089 CAGCAAATATAAATGATGGATGG + Intergenic
1110820127 13:79905510-79905532 CTGTAAAAAGACATACTGGATGG - Intergenic
1111764234 13:92507209-92507231 CTGTGAAGACAAACGGTGGATGG - Intronic
1112188791 13:97154772-97154794 CTGAATAAATAAATGGTATAAGG + Intergenic
1112437154 13:99398751-99398773 CTGTGGAAATAAAGGGTGGAGGG - Intergenic
1112853647 13:103736737-103736759 CTGAAAAAGGAAACGGTGGAAGG - Intergenic
1115306506 14:31939072-31939094 GTGTATGCATAAATGGTGGATGG - Intergenic
1116500185 14:45611519-45611541 TTATAAAAATAAATATTGGATGG + Intergenic
1116837383 14:49783409-49783431 CTGGAAAAACAAAGTGTGGAGGG + Exonic
1119053536 14:71394282-71394304 CTGTATAATTAATTGGTGAATGG - Intronic
1119149842 14:72348661-72348683 GTTTTAAAATAGATGGTGGATGG + Intronic
1119239393 14:73046376-73046398 GAGAAAAAATAAATGGTGGTGGG - Intergenic
1121134531 14:91484109-91484131 CTATAAATATAATTGTTGGATGG + Intronic
1121715321 14:96069844-96069866 CTGTAAAAATAAAGGTTGGTTGG - Intronic
1123212722 14:106775999-106776021 ATGTAAAAATAAAAGGTGATTGG - Intergenic
1123763491 15:23451354-23451376 TTGTCAAAATATCTGGTGGAAGG + Intergenic
1124454652 15:29829864-29829886 CTGTAAAAAGAAACACTGGAAGG + Intronic
1125101094 15:35913629-35913651 CTGAATGAATAAATGGTAGATGG - Intergenic
1125599002 15:40905535-40905557 CTTTAAAAAAAAAAGGCGGAGGG - Intergenic
1125620661 15:41058782-41058804 CTGTAAATATAAAAGGGGAAGGG + Intronic
1125779570 15:42252382-42252404 CTGTAAAAATGAATGGGAGCTGG - Intronic
1126834516 15:52646208-52646230 CTGGAGAAATAAAAAGTGGACGG + Intronic
1127597211 15:60497760-60497782 TGGTAAAAATAAATGATGGCTGG + Intronic
1128060671 15:64733689-64733711 CTGTAAAATTAGATGATTGATGG + Intergenic
1130230002 15:82089478-82089500 CTCAAAAAATAAATGGAGGTTGG + Intergenic
1131814017 15:96203679-96203701 TTATAAACATAAATGGTGAAAGG + Intergenic
1131903606 15:97116758-97116780 CTGCTAAAATAACTGGTTGATGG + Intergenic
1133444364 16:5847352-5847374 CTGAAAAAAAAAATGGGGGTGGG + Intergenic
1134895646 16:17884540-17884562 CTGTTAAAAGTAACGGTGGATGG - Intergenic
1135008734 16:18853900-18853922 CTTTAAAAGCAAATGATGGAGGG + Intronic
1135848083 16:25937349-25937371 TTGTAAAAATAAATAGTCTATGG - Intronic
1136129286 16:28209666-28209688 CTGAAAGAATAAATGAAGGAAGG + Intronic
1136489337 16:30596047-30596069 CTTTTAAAATGAATGGTGGCTGG + Intergenic
1136670190 16:31849664-31849686 AGGTAAAAATAAATGGTGTAAGG + Intergenic
1137236167 16:46620456-46620478 CTGCAAAAATAAATACTGCATGG - Intronic
1137687866 16:50399417-50399439 CTGTAATGACAGATGGTGGAGGG + Intergenic
1138913905 16:61439401-61439423 ATGTAAAAAGAGATGGAGGATGG + Intergenic
1140565387 16:76035756-76035778 TTGTGAAAATTAATTGTGGAAGG - Intergenic
1140853967 16:78961329-78961351 CTGTAAAACTAGTTGGTGTAAGG + Intronic
1143854229 17:9836750-9836772 CTGAAAAGATAAATGCTTGAGGG - Intronic
1145127913 17:20317009-20317031 TTGTAAAAATAAATTGTACATGG - Intronic
1146435163 17:32839038-32839060 TTGCAAAAATATATGATGGAAGG - Intronic
1148661945 17:49341320-49341342 CTGAAAAAAAAAAAGATGGATGG + Intronic
1148764004 17:50027080-50027102 TTGAATAAATAAATGATGGATGG - Intergenic
1149173233 17:53838650-53838672 CTGGAAAAATAAATGCTAGCAGG - Intergenic
1150074741 17:62182885-62182907 CTGTAGAAATAAATTCTGAAAGG - Intergenic
1150638804 17:66935393-66935415 ATGCAAAAATAAATTCTGGAAGG + Intergenic
1151069782 17:71195644-71195666 CTGTGAAAATAAATGATGAGCGG + Intergenic
1151462594 17:74263433-74263455 CTTTAAAAATAAATACTGCAGGG + Intergenic
1152958022 18:56741-56763 CTGTAAAAACAATTGGTGACTGG + Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153399166 18:4664209-4664231 CTTTTAAAACAAATGGTGGTTGG + Intergenic
1153482306 18:5559267-5559289 CTTTACAAATAAATGGAGGAGGG + Intronic
1156400963 18:36740090-36740112 TGGTAAAAATCAATTGTGGAAGG - Intronic
1156602017 18:38619202-38619224 TGGTAAAAATAAAGGGTGAAGGG + Intergenic
1156668910 18:39443687-39443709 CTATAAAAATAGATGTTGCAGGG + Intergenic
1156723991 18:40105431-40105453 CTGGACAAATAAATGATGGAGGG + Intergenic
1156879332 18:42057954-42057976 CTGAATAAAGAAATGGTAGAAGG + Exonic
1158098279 18:53800247-53800269 CTCTAAAGATAAATTGAGGATGG + Intergenic
1158179494 18:54697996-54698018 TTGTAAAAATAAATGTAGAAAGG + Intergenic
1158705033 18:59784608-59784630 CTGTAAAAATGAGTGCTGTAAGG - Intergenic
1158986682 18:62824885-62824907 CTGTTAAAAAAAATGGGGGGTGG - Intronic
1159832453 18:73293924-73293946 CTGAAAGAATAAATGCTTGAGGG + Intergenic
1161920046 19:7259191-7259213 CTGTAAAAAGAAAGGAAGGAAGG - Intronic
1162224832 19:9212169-9212191 CTCTAAAGATAAATAGTTGAGGG - Intergenic
1162270675 19:9612512-9612534 CTATAAAAATAAATTGAGGCTGG - Intronic
1162275903 19:9654741-9654763 CTATAAAAATAAATTGAGGCCGG - Intronic
1163511561 19:17738592-17738614 CTCAAAAAATAAAAGGGGGAGGG + Intergenic
1165115078 19:33523708-33523730 ATGTCAAAAGAAATGGTGGGAGG - Intergenic
1165678151 19:37746351-37746373 ATACAGAAATAAATGGTGGACGG + Intronic
1165867574 19:38948446-38948468 ATGAATAAATAAATGGGGGAAGG + Intronic
1167681277 19:50923130-50923152 CTTAAAAAAAAAATGGTGCAGGG + Intergenic
925020064 2:562202-562224 CAAAAACAATAAATGGTGGAGGG - Intergenic
925213889 2:2075588-2075610 CTGTAAGAATCATTGGAGGAGGG + Intronic
926365509 2:12129615-12129637 CTGTGGAAATAAAGGGTTGAAGG - Intergenic
928026404 2:27742963-27742985 CATCAAAAATAAATGGTGGAGGG - Intergenic
928542793 2:32299168-32299190 CTGTAAGAATAAATTCTGGCTGG - Intronic
928677778 2:33666657-33666679 GTGTAAAAAAAAATTATGGAAGG - Intergenic
929261059 2:39866997-39867019 CTGTAAAAACATATGTTGAATGG + Intergenic
931190413 2:59995058-59995080 CTGTAAAAATAAAAGGTACAAGG - Intergenic
932309978 2:70731969-70731991 CTTCAAAAATGAAAGGTGGAAGG - Intronic
934919889 2:98334332-98334354 CTGAAACAAGAAAAGGTGGAAGG + Intronic
936688197 2:114853492-114853514 CTATAAAAATTAATAGTGCATGG - Intronic
937639386 2:124194166-124194188 CAGAGAAAATAAATGGGGGAGGG - Intronic
937792062 2:125972368-125972390 TGTTTAAAATAAATGGTGGATGG + Intergenic
937933223 2:127221428-127221450 CTTAAAAAATAAATGTTGGCCGG - Intergenic
938717469 2:134034061-134034083 AGGTATAAATAAATGGTGGGGGG - Intergenic
940483780 2:154271895-154271917 CTATAAAAATAAATGCTGAATGG + Intronic
940990805 2:160094405-160094427 CTTCAAAAATAAATGGTGCTGGG + Intergenic
943238951 2:185360206-185360228 CTGTCAAAAAAAAGGGGGGAGGG + Intergenic
943403615 2:187450673-187450695 CAGAAAAAATAAATGGTACAAGG + Intergenic
943738834 2:191388876-191388898 CTGTAAAAATAAAAAAAGGAGGG - Intronic
943984866 2:194605817-194605839 CTTTAAAAAAAAATGGGGGAAGG + Intergenic
944868200 2:203882841-203882863 CTGGAAAAAAAAATAGTGAATGG + Intergenic
945304801 2:208249047-208249069 CTTTAAAAATAAAAGGGGGTGGG + Intronic
946929861 2:224660865-224660887 CAATAAAAATAAATGTTGGGTGG - Intergenic
947998287 2:234546873-234546895 GTGTAACAGTAAATGGGGGAAGG - Intergenic
948626264 2:239270235-239270257 GTGTAAAAATGAATGGATGACGG + Intronic
1169507470 20:6227513-6227535 TTTTAAAAATAAATGGTGGAGGG + Intergenic
1169902185 20:10564780-10564802 CAGTAAAAATTAATGGTATAAGG + Intronic
1169931100 20:10833988-10834010 CTATAAAAATACATGCTGGGAGG + Intergenic
1170053215 20:12170172-12170194 CTGAAAAAGTACATGATGGAGGG - Intergenic
1171470965 20:25370982-25371004 AATTAAAAATAAATGGTGAAGGG - Intronic
1172168399 20:32913308-32913330 CTGTAAACTTACATGGTGGAAGG + Intronic
1172381966 20:34501906-34501928 CTGCAAAAATAAATTATAGATGG + Intronic
1172921502 20:38486715-38486737 TAGTAAAAATAAAAGTTGGATGG - Intronic
1174145327 20:48449230-48449252 CTTTAAAACTAAGTGGGGGAAGG + Intergenic
1174656259 20:52174980-52175002 TTGGAAAAATAAATGTTGAAAGG - Intronic
1175002317 20:55642601-55642623 CTTTCAGAATATATGGTGGAGGG - Intergenic
1175013322 20:55762279-55762301 GTGTAAAAATAAAGTGTGCACGG - Intergenic
1175238801 20:57531223-57531245 CTGTAAAAAAGAGTGGTCGAAGG - Intergenic
1178003258 21:28188310-28188332 CTGAAAAGATAAATGCTTGAGGG - Intergenic
1180208876 21:46281523-46281545 CTGTAAAAACAAAAGGGGGTTGG + Intronic
1180300166 22:11030983-11031005 CTTTTAAAATTAATGGTGCATGG + Intergenic
1182700091 22:32229814-32229836 CTCAAAAAATAAATGCTTGAGGG + Intronic
1185208692 22:49554736-49554758 CTGTCAGAATCAATGGTGGGAGG - Intronic
949916117 3:8965894-8965916 TTGTTAAAATGAATGGAGGAAGG - Intergenic
950082997 3:10236710-10236732 CTGAAAGAATAATTGGTTGAAGG - Intronic
951234354 3:20217361-20217383 AGGTAAAAAGAAATGGTGCAGGG + Intergenic
951441132 3:22725480-22725502 ATGGATGAATAAATGGTGGATGG - Intergenic
952094671 3:29935401-29935423 TTTTAAAAAAAAATTGTGGATGG + Intronic
952493369 3:33893624-33893646 CTGCTAAAATAAATCATGGATGG - Intergenic
953029149 3:39166135-39166157 CTGAAGAAAAAAAGGGTGGAAGG + Intergenic
953843532 3:46408709-46408731 ATGTAAAAATAAATAGGGGGAGG - Exonic
955481050 3:59390793-59390815 CTCTAAGAATAAATGCTTGAGGG - Intergenic
956155286 3:66289582-66289604 CTGAAAAAAGCAATGGGGGAAGG - Intronic
957178286 3:76841500-76841522 CAGGAAAAATAAAAGGGGGAGGG - Intronic
957640912 3:82852137-82852159 CTGTAAAAAAAAATAGGGCAGGG + Intergenic
957682734 3:83458629-83458651 CTGCAAAAATAAATTCTGAAAGG + Intergenic
958183529 3:90088764-90088786 CTTTAAATATAAGTTGTGGATGG - Intergenic
958847570 3:99283254-99283276 CTGGAAAAATAAATGCTTGAGGG + Intergenic
959105966 3:102064248-102064270 CTGTATGAATAAATAGTGCATGG - Intergenic
959885560 3:111495991-111496013 CTGTAAGAATTTATGGTGGATGG - Intronic
960115631 3:113889585-113889607 CTGTTAAAAGAAATGGTTTAAGG + Intronic
960421007 3:117445150-117445172 CTGTAAAAATAGATTAAGGATGG - Intergenic
960755854 3:121011372-121011394 CTATAAAAATAAAGGGTTGCAGG - Intronic
960827112 3:121800025-121800047 CTGTAAAAATAGAGGTTGGCTGG + Intronic
961445071 3:126976572-126976594 CTTGAAAAATGAATGGTGGCTGG + Intergenic
961891205 3:130131553-130131575 CTATAAAGATTACTGGTGGAGGG - Intergenic
962015544 3:131436181-131436203 CTCAAAAAATAAGTGGAGGAAGG + Intergenic
962371103 3:134821505-134821527 GGGTAAAGATAAAAGGTGGATGG + Intronic
962451987 3:135527476-135527498 CTGTAACCTTACATGGTGGAAGG - Intergenic
962714959 3:138117983-138118005 CATTAAAAAAAAATAGTGGATGG + Intergenic
963380407 3:144522853-144522875 CTGAAAACAAAAATGGTGAAAGG + Intergenic
963688603 3:148470319-148470341 TTGGAAAAAAAAATGGTGGAGGG + Intergenic
964206769 3:154183682-154183704 ATGTAAAAATAAAAGGTGGGTGG + Intronic
965601863 3:170462511-170462533 CTGTTTAAATAAATGGCGGGCGG - Exonic
967171896 3:186828278-186828300 CTGTTAAAATAATTGGTGTGGGG - Intergenic
969424946 4:7118664-7118686 ATGGAAAGATGAATGGTGGATGG + Intergenic
970403317 4:15738538-15738560 ATTTAAAAATATATGTTGGAAGG + Intergenic
971033480 4:22667005-22667027 TTTTAAAAATAAATGGTGATGGG - Intergenic
971307505 4:25496472-25496494 CTGGAGAGATAAATGGTGGCAGG - Intergenic
971654245 4:29321676-29321698 CTGTATAAATAAGGGCTGGATGG + Intergenic
971769237 4:30874980-30875002 CTGTAACAATAAATGGGTGAAGG - Intronic
971903024 4:32686945-32686967 CTGCAAAAGCAAATGGTGGTGGG + Intergenic
972008321 4:34140666-34140688 CTATAAAAATACATGGTGTAAGG + Intergenic
972143585 4:35992953-35992975 CTGCAAAAATAAATGGTAGTTGG - Intronic
972242633 4:37209833-37209855 CTGTAAAATTAAATGAGAGAAGG - Intergenic
972322718 4:37987285-37987307 CTGAAAAAAAAAAAAGTGGAAGG - Intronic
972890377 4:43550725-43550747 CTCAAAAAATAAATGCTTGAGGG - Intergenic
973431235 4:50153856-50153878 CTGTAAAAAGAAATGTTCAACGG - Intergenic
973442531 4:50340565-50340587 CTGTAAAAAGAAATGTTCAACGG - Intergenic
973802001 4:54487430-54487452 CTGTGAACTTACATGGTGGAAGG - Intergenic
974085342 4:57254610-57254632 CTGGCAAAATGAATGCTGGATGG - Intergenic
974449491 4:62034199-62034221 CTGTAAAAATAAAAGGCAGCTGG - Intronic
974728034 4:65822019-65822041 CTTAAAAAATAAAAGGAGGAAGG - Intergenic
974816398 4:67010366-67010388 CTGTAAAGAAAAAGGGTGGGTGG + Intergenic
974982929 4:68983635-68983657 ATGGAAAAATAAATTGTAGATGG - Intergenic
975017611 4:69442498-69442520 ATGGAAAAATAAATTGTAGATGG + Intergenic
975118825 4:70706289-70706311 CTTTAAAAATATAGGGTGTATGG - Intronic
975155996 4:71073753-71073775 CTGTATAAATACTTGATGGATGG + Intergenic
975783863 4:77867143-77867165 CAATAAAAATAATTGGGGGATGG - Intronic
976068772 4:81218307-81218329 CTGGAAAAAAAAAAAGTGGAGGG + Intergenic
976935073 4:90621113-90621135 CTGTAAAAAACACTGGTGGCCGG - Intronic
977162036 4:93646857-93646879 CTGAACAAATAAATGGATGATGG + Intronic
977475252 4:97499328-97499350 ATGAAAAAATAAATTGTGGACGG - Intronic
978912875 4:114085360-114085382 CTGAAAAAATAAAGTGTAGATGG - Intergenic
979416768 4:120450904-120450926 ATGTACAAATGAATGTTGGAGGG + Intergenic
979490020 4:121315286-121315308 CTGTTAAAATGAGTGGTGGATGG - Intergenic
980467355 4:133203148-133203170 CTGTAAAGATGTATGGTGTAGGG + Intronic
980478885 4:133358610-133358632 CTGTAAAAAATAATGGAAGATGG + Intergenic
981018379 4:139999605-139999627 ATTTAAAAATAAATGTTGGGTGG - Intronic
981165088 4:141548290-141548312 CTTCAAAAATATATGGTTGATGG + Intergenic
981974402 4:150707147-150707169 CTGTAAGGATAAGGGGTGGAAGG + Intronic
982163202 4:152590641-152590663 CTGTAAAGTTAATTGGTGAATGG - Intergenic
982481034 4:155910002-155910024 CTTTGAGATTAAATGGTGGAAGG - Intronic
984088204 4:175338375-175338397 TGGTAAAAAAAAATGGTGGCTGG - Intergenic
984183184 4:176510309-176510331 CTGTAAAGTTATATGGTAGAGGG - Intergenic
985147075 4:186904397-186904419 CTGGAAAAATAAATGGGAGTTGG - Intergenic
985761197 5:1749799-1749821 CTGTAAAAAGAAACGCTGGGAGG + Intergenic
988045459 5:25945781-25945803 TTGAAAAAAAAAATGGTGAAAGG + Intergenic
988821230 5:34888129-34888151 CTGTAAACTCACATGGTGGAAGG - Intronic
988838670 5:35061195-35061217 CTTTAAAAAAAAATAGAGGAAGG + Exonic
988869341 5:35371752-35371774 CTTGAAAAATGAGTGGTGGAAGG + Intergenic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
990732712 5:58826992-58827014 CTCTAAGAATATTTGGTGGAAGG - Intronic
990966481 5:61454051-61454073 TTGAATAAATAAATGGGGGAAGG - Intronic
992376330 5:76191382-76191404 GTTTATAAATAAATGGTGCAAGG + Intronic
992783234 5:80146753-80146775 CTGTTAAAATAAATGTGGCAGGG - Intronic
993401305 5:87455959-87455981 CTGAAAAAAAAAATAGGGGAAGG + Intergenic
994380117 5:99060874-99060896 CTGGGAAAATAAATGCTGAATGG - Intergenic
998027218 5:138828708-138828730 CTGTAAAAGTTAATGGGTGATGG + Intronic
998874919 5:146589436-146589458 ATGGAAAAAAAAATGGTGGAGGG + Intronic
998876306 5:146603513-146603535 CTCCACAAATAAATGGTGGTAGG - Intronic
998941454 5:147287484-147287506 CTGTAATAATTAAAGATGGATGG - Intronic
999846614 5:155488388-155488410 CTGTATAATCACATGGTGGAAGG - Intergenic
999876288 5:155810044-155810066 CTGTAACAATAATTGATGTAGGG + Intergenic
1000763416 5:165254814-165254836 CTGAAATAATAAAGGGAGGAAGG - Intergenic
1001848772 5:174944541-174944563 CAGTAAAAAGACATGGAGGATGG + Intergenic
1002687068 5:181021072-181021094 CTGTAAAAATGTGTGGTGGCAGG - Intergenic
1003192181 6:3883945-3883967 CTTAAAAAAAAAAAGGTGGAGGG + Intergenic
1003514690 6:6808123-6808145 CTGCAAAGATAAAGGGTGGCAGG - Intergenic
1003804585 6:9712900-9712922 CTTTAAAAAAAAATGGAAGAAGG + Intronic
1004790328 6:19018968-19018990 ATGAAAAAACAAATGGTGGGAGG + Intergenic
1005055039 6:21721151-21721173 CTTTAATAATAAAAGGGGGAGGG - Intergenic
1005562832 6:27058882-27058904 CTGTAAAATTTAATGCTGGTGGG + Intergenic
1005735837 6:28745000-28745022 CTGAAGAAATGAATGGAGGAGGG + Intergenic
1006620514 6:35360777-35360799 CTCTAAAAATAAATCGGGGATGG - Intronic
1007645588 6:43378058-43378080 CTGTAAACATTACTGGTGTAAGG + Intergenic
1008549626 6:52615239-52615261 CTGTGAAAAAATATGGTGCATGG + Intergenic
1009398193 6:63227378-63227400 ATTTTAAAATAAAGGGTGGATGG + Intergenic
1010155086 6:72783181-72783203 CTGTAGAGAGAGATGGTGGAGGG + Intronic
1011048498 6:83115366-83115388 CTGTAAAAATTAATTGTGTGAGG - Intronic
1011055666 6:83200909-83200931 CTGGAAAAATAAGTGGGGGATGG + Intergenic
1011288410 6:85749667-85749689 CTGTAACTATTACTGGTGGAAGG - Intergenic
1012620152 6:101334420-101334442 CTCTAAGAATAAATGCTTGAAGG - Intergenic
1013929023 6:115507619-115507641 CTGTTAAAGGAAATGATGGAGGG - Intergenic
1014568700 6:122982820-122982842 CTGAAAAAATAAATGCTAAAGGG + Intergenic
1016034333 6:139370620-139370642 CTGGCAGAATAAATGGTGAAGGG + Intergenic
1016088213 6:139942421-139942443 CTGAAAAAATAAAGGCTGAAAGG - Intergenic
1016447261 6:144146882-144146904 CTGAAAAAGTAAATTGTGGATGG + Intergenic
1016447350 6:144147703-144147725 CTGAAAAAGTAAATTGTGGATGG - Intergenic
1016955899 6:149626576-149626598 ATGTAAAAGTAAATGTTGGCCGG - Intronic
1017289508 6:152719666-152719688 ATGTGACAATATATGGTGGAAGG + Intronic
1018325553 6:162663920-162663942 CTCTAAAAAAAAAAGGTGGGGGG + Intronic
1019826698 7:3290453-3290475 TTGAAAGAATAAATGGTGGAAGG - Intergenic
1020768656 7:12358371-12358393 CTCAAAAAATAAAAGGTGGGGGG + Intronic
1021642111 7:22748212-22748234 ATGGAGAAATAAAAGGTGGATGG + Intergenic
1021743589 7:23714152-23714174 ATGTAAAAAAAAATTGTAGAAGG + Intronic
1022126280 7:27360770-27360792 ATATAAAAATGAATGGTGGCTGG + Intergenic
1022185782 7:27967035-27967057 CTGTAATAAGAAATGGTAGTTGG - Intronic
1022871502 7:34484913-34484935 CTCAAAAGATAAATGCTGGAAGG + Intergenic
1023334816 7:39157888-39157910 CAGTAAAAATGAATGCTGGATGG + Intronic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1025907458 7:65798859-65798881 CTGGAAAAATAACTGTGGGATGG + Intergenic
1026042266 7:66878011-66878033 CTGGAAAAATAACTGTGGGATGG + Intergenic
1027488776 7:78795896-78795918 CTGTTTAAATAAATGGTGCCAGG + Intronic
1027502999 7:78978923-78978945 CTGAATAAATGAATGGTGGATGG + Intronic
1027619404 7:80464992-80465014 CTTGCAAAATAAATGGAGGAAGG + Intronic
1029035580 7:97517595-97517617 GTGTAAAAATAAAGGGTAGCAGG + Intergenic
1030018279 7:105246040-105246062 CTGCAAAAAGAAAAGCTGGAAGG + Intronic
1030092027 7:105866180-105866202 CTGTGAACATTAATGGTGTAAGG - Intronic
1030301711 7:107980874-107980896 CTCTAAAAAGAAATGATGCAAGG - Intronic
1030478075 7:110062867-110062889 CAGTAAAAATACATGGAGCAAGG - Intergenic
1030521188 7:110600060-110600082 CTGCAAAAGTAAAATGTGGAAGG + Intergenic
1030878108 7:114841453-114841475 CAGTAATAATAAATAGTGTAAGG + Intergenic
1032158713 7:129492953-129492975 GTGTAAAAAAAAATGTTGGTAGG - Intergenic
1032381617 7:131489680-131489702 CTGTAAAAATAAATGGTGGAGGG - Exonic
1032531822 7:132627196-132627218 ATGTAAAAATAAATGGCAGAAGG - Intronic
1032651993 7:133889101-133889123 CTTTTAAAATAAATCATGGAAGG + Intronic
1034724633 7:153324176-153324198 CCGTAAAAATATATGGTGGATGG - Intergenic
1035956732 8:4088745-4088767 CTGTTGGAATAAATGGTGGTGGG - Intronic
1036876268 8:12475687-12475709 CTATAAAGATTACTGGTGGAGGG - Intergenic
1037846670 8:22288993-22289015 GTGTAAAAATATTTGCTGGAAGG + Intronic
1038130422 8:24724405-24724427 ATGTAAAAACAAAGTGTGGATGG + Intergenic
1039154020 8:34535378-34535400 CTGTAAAAGAAATTGTTGGAGGG + Intergenic
1039164849 8:34666607-34666629 CAGTGAAAATAAAGGGTGGGGGG + Intergenic
1039543382 8:38389512-38389534 GTGAATAAATAAATGGTGGCCGG - Intronic
1040898963 8:52397300-52397322 ATGTAAAAATAAATGAGTGAAGG - Intronic
1041546613 8:59051719-59051741 CTTTAAAAATACCTGTTGGATGG + Intronic
1041694150 8:60717950-60717972 ATTTAAAAAAAAATGGTAGAAGG - Intronic
1043683175 8:83056902-83056924 CTCTAAAAATAAATGTTTGCAGG + Intergenic
1043693939 8:83194967-83194989 ATGTAAAAATAAATTTTAGAAGG - Intergenic
1044548180 8:93482655-93482677 CTGAAAAAATAAAAGTTAGAGGG - Intergenic
1045250323 8:100477885-100477907 CTGAAAAACTAAATGTTGGAAGG + Intergenic
1045434653 8:102149903-102149925 CTTTGAAACTAAATGGTGGATGG + Intergenic
1046951656 8:120025349-120025371 CAGAAAAAAAAAATGGTGGGTGG - Intronic
1047376967 8:124308587-124308609 ATAAATAAATAAATGGTGGAGGG + Intergenic
1047849950 8:128845962-128845984 ATTTATAAATAAATGGTGGCTGG + Intergenic
1048621529 8:136138359-136138381 CTGTCAAACTAATTTGTGGATGG + Intergenic
1049026573 8:139995100-139995122 CTCAAAAAATAAATGTTAGAAGG + Intronic
1050042149 9:1507274-1507296 CTGTAAAAATATCAGGTGGCAGG + Intergenic
1050113755 9:2242276-2242298 ATGCAAAAAGAAAGGGTGGAAGG + Intergenic
1050172027 9:2829966-2829988 ATGGAAAAATAAATGATAGAAGG + Intronic
1050172868 9:2841139-2841161 GTGTATAAATAAATTGTAGATGG - Intronic
1051148790 9:14058579-14058601 ATATAAAAATAATTGATGGAGGG + Intergenic
1051883279 9:21862302-21862324 TTGCAACAATAAAGGGTGGAGGG + Exonic
1051923230 9:22292295-22292317 CTCAAAAAATAAATGCTTGAGGG - Intergenic
1051962962 9:22790268-22790290 ATTAAAAAATAAATGCTGGAGGG + Intergenic
1052043792 9:23771059-23771081 CTGTGAAAATAAATTGTGTGTGG + Intronic
1052739084 9:32376104-32376126 CTGTAACAATAGCTGCTGGAAGG + Intergenic
1053485453 9:38451082-38451104 ATGAAAATATAAATTGTGGAAGG - Intergenic
1053552655 9:39100629-39100651 CTCTAAAAATAAAGTGTGAAAGG + Intronic
1053816771 9:41920793-41920815 CTCTAAAAATAAAGTGTGAAAGG + Intronic
1054107031 9:61064475-61064497 CTCTAAAAATAAAGTGTGAAAGG + Intergenic
1054613826 9:67266650-67266672 CTCTAAAAATAAAGTGTGAAAGG - Intergenic
1055144603 9:72918027-72918049 CTGTAAATACAAATGGTTCATGG - Intronic
1055744752 9:79430982-79431004 CTTTAAAAATAAATGACTGAGGG + Intergenic
1056947988 9:91017126-91017148 CTCAAAAAATAAATGTTTGATGG + Intergenic
1057113535 9:92498219-92498241 TTGCAAAAATAAATACTGGAAGG + Intronic
1057835177 9:98438710-98438732 CAGTAATAAAAAATGGTGGCAGG - Intronic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058092630 9:100822864-100822886 CTGTAACAATAAATGGAGAATGG - Intergenic
1058156856 9:101525409-101525431 CTATGAAAATAAATGTTGGCGGG + Intronic
1058194940 9:101961250-101961272 CTGGAAAAATAAATAGTTAAAGG - Intergenic
1058340989 9:103896121-103896143 GTGAAAAAATAAATAGGGGAGGG + Intergenic
1058351023 9:104024157-104024179 CTGTAAATTTGAATTGTGGAAGG - Intergenic
1058665456 9:107310213-107310235 CTGCAAAAATAAATTATAGATGG + Intronic
1059212241 9:112524205-112524227 CTGTTGAAATAAAATGTGGATGG + Intronic
1060040027 9:120292252-120292274 TTGTAGAAAGCAATGGTGGATGG - Intergenic
1061481592 9:130900065-130900087 CTCTAAAAATAAATGATGAGAGG + Intergenic
1061964092 9:134003479-134003501 ATGTACAGATGAATGGTGGATGG - Intergenic
1185676275 X:1851795-1851817 CTGTAAAGTGACATGGTGGAGGG + Intergenic
1185823002 X:3222604-3222626 CTGTTAAAATTAATGTTTGAGGG + Intergenic
1186955865 X:14681423-14681445 GTGGATAAATACATGGTGGATGG - Intronic
1187071099 X:15889223-15889245 CTGTAAGAACAAATGGAGGAGGG + Intergenic
1187735922 X:22303604-22303626 CTGTAAATCTGAATGGTGGTCGG + Intergenic
1187801788 X:23071820-23071842 CTGTAAATATATATCATGGAGGG - Intergenic
1187833967 X:23412044-23412066 CTCAAAAAATAAATGTTTGAGGG + Intergenic
1187853648 X:23615821-23615843 CTGAAAGAATAAATGCTTGAGGG - Intergenic
1188895418 X:35661725-35661747 CTGTAAAGATAATGGCTGGAAGG + Intergenic
1189451317 X:41134072-41134094 CAGAAAAAAAATATGGTGGAGGG - Intronic
1189539581 X:41971953-41971975 CTGTTAAAATAAGTGGTGGGGGG - Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1190386474 X:49886629-49886651 AGGTAAAAGAAAATGGTGGATGG + Intergenic
1191724542 X:64265731-64265753 CTGTAAAACTAAAAGGTGTTTGG + Intergenic
1192088401 X:68125789-68125811 CTGAAAAAATAGAGGGGGGAGGG + Intronic
1193079232 X:77389827-77389849 CACTAAAAATAAATGCTTGAGGG + Intergenic
1193292714 X:79794968-79794990 ATGCAAAAATAATTGGTGTATGG - Intergenic
1193359613 X:80565224-80565246 CCTTAAAAAAAAATGGTGCAGGG + Intergenic
1193754895 X:85396742-85396764 CTCAAAAAATAAATGCTTGAGGG - Intergenic
1194013820 X:88594758-88594780 TTGGAAAAATAAATGGGGGAAGG + Intergenic
1194311404 X:92312690-92312712 CTGTAAAAATGATTTGTGGCTGG - Intronic
1194857492 X:98951870-98951892 CTCAAAAGATAAATGCTGGAGGG - Intergenic
1195267362 X:103195831-103195853 CTTTAAAAATAGATAGTGGCCGG + Intergenic
1195506341 X:105661632-105661654 CTATAAAAATACATGGAGGCTGG + Intronic
1195693500 X:107649085-107649107 GTCTAAAAAAAAATGGTGGTAGG - Intronic
1196393159 X:115231041-115231063 ATTTCAAAATAAATGGGGGAAGG - Intronic
1196666805 X:118325766-118325788 CTATAGATATAAGTGGTGGACGG - Intergenic
1196817896 X:119679482-119679504 CTGTGACAATAAATGCTGGTTGG + Intronic
1197066904 X:122244527-122244549 AGGAACAAATAAATGGTGGATGG + Intergenic
1198063408 X:133070918-133070940 CTATAAAATTAAATGGTGGCCGG + Intronic
1198504741 X:137290336-137290358 CTGTAAAAGGAAATGGAGGAGGG + Intergenic
1199195514 X:145025055-145025077 CTGTAAAAGTAAATGAAAGAAGG + Intergenic
1199272839 X:145905143-145905165 CTGCATAAATAAATTGTTGAGGG + Intergenic
1200023368 X:153231028-153231050 CTTCAAAAATAAATAGTGGCTGG - Intergenic
1200031641 X:153301819-153301841 AATTAAAAATAAATAGTGGATGG + Intergenic
1200646570 Y:5792112-5792134 CTGAAAGAATAAATGCTTGAGGG - Intergenic
1202270176 Y:23063980-23064002 CTGTAAAACTGAATGCTAGATGG + Intergenic
1202295851 Y:23356702-23356724 CTGTAAAACTGAATGCTAGATGG - Intergenic
1202423170 Y:24697725-24697747 CTGTAAAACTGAATGCTAGATGG + Intergenic
1202447619 Y:24972361-24972383 CTGTAAAACTGAATGCTAGATGG - Intergenic