ID: 1032382942

View in Genome Browser
Species Human (GRCh38)
Location 7:131503239-131503261
Sequence GCTGATGGGGGGCCCCGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 317}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032382931_1032382942 23 Left 1032382931 7:131503193-131503215 CCTGTCCTTCCTGGCTGCTTTAA 0: 1
1: 0
2: 3
3: 34
4: 309
Right 1032382942 7:131503239-131503261 GCTGATGGGGGGCCCCGGGAAGG 0: 1
1: 0
2: 1
3: 24
4: 317
1032382934_1032382942 14 Left 1032382934 7:131503202-131503224 CCTGGCTGCTTTAATGGATTGTC 0: 1
1: 0
2: 1
3: 64
4: 577
Right 1032382942 7:131503239-131503261 GCTGATGGGGGGCCCCGGGAAGG 0: 1
1: 0
2: 1
3: 24
4: 317
1032382933_1032382942 18 Left 1032382933 7:131503198-131503220 CCTTCCTGGCTGCTTTAATGGAT 0: 1
1: 1
2: 53
3: 432
4: 813
Right 1032382942 7:131503239-131503261 GCTGATGGGGGGCCCCGGGAAGG 0: 1
1: 0
2: 1
3: 24
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032382942 Original CRISPR GCTGATGGGGGGCCCCGGGA AGG Intronic
900127286 1:1074161-1074183 GCTGGTGGCCGGCCCCGGGGAGG - Exonic
900339176 1:2179748-2179770 GCTGGTGGGAGGCCCCAGGGAGG + Intronic
900380824 1:2382979-2383001 TCAGATGTGGGGCCCCTGGAGGG - Intronic
900420518 1:2554120-2554142 GGTAATGGTGGGCCCCGGGATGG + Intergenic
900996127 1:6124575-6124597 GCAGACGGCGTGCCCCGGGAGGG - Exonic
901026734 1:6282310-6282332 GCTGACCTGGGGCCCCGGGAAGG + Intronic
902337365 1:15761145-15761167 GCTGCTGTGGGGCTTCGGGATGG - Intronic
902925592 1:19693876-19693898 GCTGTTGGGGAGCCCTGGGTGGG + Intronic
902955691 1:19923033-19923055 GCTGGTGGGGAGCCCCTGGAAGG - Intronic
904333760 1:29784242-29784264 GCTGATGGGGGGAGCAGGGCTGG - Intergenic
904387656 1:30155236-30155258 GGTGATGGGGGGCTAGGGGAGGG - Intergenic
905865038 1:41372027-41372049 CGAGATGGAGGGCCCCGGGAAGG + Intronic
905901518 1:41584604-41584626 ACTGATGAGGGGCCCGGGAAGGG + Exonic
906035297 1:42747003-42747025 GCTGAAGTGGGGCCCAAGGAGGG + Exonic
906113164 1:43337983-43338005 GGTGATGCAGGGCCCCGGGAGGG + Intronic
906199016 1:43947470-43947492 GGTGAGGGGGGGCCCAGGGCGGG - Exonic
907247580 1:53117852-53117874 GCTGATGGGGGCCCCAGGGTGGG - Intronic
907689246 1:56645608-56645630 GCGGAGCTGGGGCCCCGGGAGGG + Intronic
914677032 1:149913479-149913501 GCAGATGGGGCGCCCCTGGCTGG - Exonic
915323238 1:155067471-155067493 GCTAATGTGGGGCCTTGGGAAGG + Intronic
915587362 1:156851499-156851521 GCTGAATGGGGGCCCCGGGAAGG + Intronic
916773633 1:167937008-167937030 GGTGAGCGGGGGCCCCGGGGCGG + Exonic
919784731 1:201251994-201252016 GCTGATGGGGGGCTCCAAGGTGG + Intergenic
922616777 1:226965413-226965435 GCGTATGGGAGGCCCCTGGAGGG + Intronic
922729412 1:227942074-227942096 GCTGCTGGGGTGGCCCGGGCTGG - Intronic
924567906 1:245213242-245213264 GCTGGTGGGGGGCCTGGAGAGGG + Intronic
1063367786 10:5501473-5501495 CCTGGTGAGGGGCCCAGGGAGGG + Intergenic
1063379574 10:5575924-5575946 GCTGAGGGTGGGCCTCAGGAGGG + Intergenic
1063694145 10:8316753-8316775 GTTGAAGGGGGGGCCCTGGAGGG - Intergenic
1066610999 10:37248474-37248496 GCTGATGGGGGGAAGCAGGAAGG - Intronic
1067572852 10:47384419-47384441 GCGGGTGGGCGGCCCCGGCAGGG + Intergenic
1068737587 10:60431647-60431669 GCTGGTGGGGGGGCTAGGGAAGG + Intronic
1069957390 10:72060461-72060483 GATGCTGGGGGGCCTGGGGAAGG - Exonic
1070149506 10:73797230-73797252 GGGGATGGGGGTCCCCAGGACGG + Exonic
1070916594 10:80158998-80159020 GCTGATGGGTGACACCGTGAAGG - Intronic
1071651276 10:87394977-87394999 GCTAATGGGGGGCCGAGGCAGGG + Intergenic
1073125361 10:101145878-101145900 GCTGGTGGGGGGCGGGGGGAGGG + Intergenic
1074843431 10:117376040-117376062 GCGGAGGGTGGGCCCTGGGAAGG + Intergenic
1075355032 10:121764126-121764148 AATGATGGGGGGCTCAGGGAAGG + Intronic
1075657813 10:124173660-124173682 GCTGATGAGGGCCCCGGTGAAGG - Intergenic
1075668184 10:124245369-124245391 GTAGATGGTGGGCCCAGGGAAGG + Intergenic
1077095151 11:796004-796026 GCCTCTGGGGGGCCCAGGGAGGG - Intronic
1077227129 11:1443292-1443314 GCTGTTGGGGGGCGCAGGGCAGG - Intronic
1077287563 11:1774420-1774442 GCTGCAGGGAGGCCCAGGGAGGG + Intergenic
1077305376 11:1866588-1866610 GCTTATGGGGGGCCAGGGGTAGG - Exonic
1077405210 11:2379513-2379535 GCTGAAGGGGAGTCACGGGAGGG + Intronic
1080587211 11:33693075-33693097 GCTGAGGGGGAGCCCCTGCAGGG - Intergenic
1081484110 11:43514989-43515011 GCTGAGAGGGGGCCCTGGGGAGG - Intergenic
1084264447 11:67997659-67997681 GCTGCTGGTGCGGCCCGGGATGG - Exonic
1084431809 11:69115515-69115537 GCTGGTGAGGGGTCCTGGGAAGG - Intergenic
1084673760 11:70622546-70622568 GCTGAGGGAGGGCCCCGGAACGG - Intronic
1084709668 11:70836128-70836150 GCCCATGGGGGGCCAGGGGAAGG + Intronic
1084827609 11:71743050-71743072 AGGGAAGGGGGGCCCCGGGAAGG + Intergenic
1084956444 11:72694064-72694086 CCTGATGGGGGCCACAGGGAGGG - Intronic
1085728745 11:78978203-78978225 GCGGATGGGGGGCTAGGGGAGGG + Intronic
1086523369 11:87697367-87697389 GCCAAGAGGGGGCCCCGGGATGG + Intergenic
1088912006 11:114199155-114199177 ACGGATGCTGGGCCCCGGGACGG + Intronic
1089163593 11:116458072-116458094 GCTGGTGGGGGGCCAGGGGCGGG + Intergenic
1089258086 11:117204577-117204599 GGTGATGGGGGCAGCCGGGAGGG - Exonic
1090064528 11:123491664-123491686 GCAGATGGAGGGCCCAGGGTGGG - Intergenic
1090203752 11:124873740-124873762 GCTGAGAGGGAGCCCCCGGAGGG - Exonic
1090279669 11:125445157-125445179 GTTCATGGAGGGCCGCGGGAAGG + Intergenic
1091250715 11:134141680-134141702 GCTGGTGGGGGGCCCCAAGCTGG + Intronic
1091280869 11:134380782-134380804 GCTGAGGGTGGGGCCGGGGAGGG + Intronic
1091646319 12:2274848-2274870 GCTGGTGTGGGGCCCCGGCTGGG + Intronic
1092200921 12:6582195-6582217 GCTGATGGTGTCCCCCGAGAAGG - Exonic
1092415653 12:8288658-8288680 AGGGAAGGGGGGCCCCGGGAAGG - Intergenic
1093771567 12:23023604-23023626 GCTGATTGGGGGCACAGGGTGGG + Intergenic
1096115033 12:49050639-49050661 GCTGATGGGTGTCTCCAGGATGG + Exonic
1096878243 12:54647017-54647039 GCAGAAGGGGGGTCCGGGGAAGG - Intronic
1097006994 12:55926972-55926994 GCAAAGGAGGGGCCCCGGGATGG + Intronic
1097622861 12:61962890-61962912 GCTGGTGGGGGGCTAGGGGAGGG - Intronic
1098707498 12:73708884-73708906 GCTGTTGGGGGGCATAGGGAGGG + Intergenic
1099882005 12:88478224-88478246 GGGGATGGGGGGCCAGGGGAGGG + Intergenic
1103087259 12:118071185-118071207 GGTGATAGGGTGTCCCGGGATGG + Intronic
1103920364 12:124396176-124396198 GCTGGGGCGGGGCCCTGGGAGGG + Intronic
1104054987 12:125222743-125222765 GCTGATGGAAGGGCCAGGGATGG - Intronic
1104093233 12:125533411-125533433 GCAGCTGGAGGGCCCTGGGAAGG - Intronic
1104633799 12:130425438-130425460 GCTGTTGGTGGGGCCGGGGATGG - Intronic
1104680105 12:130744353-130744375 GCTGCTGGGTGGCTCAGGGAAGG - Intergenic
1105328982 13:19396662-19396684 GATGATGGGGGGTGCAGGGAAGG + Intergenic
1105430625 13:20334103-20334125 GCTGATTGGTGGCCCCTGTATGG - Intergenic
1105722901 13:23134622-23134644 GGTGATGGTGGGCCTGGGGAAGG - Intergenic
1110439119 13:75507875-75507897 GCTCATGGGCGGCCACGGGCAGG + Intergenic
1110531366 13:76602531-76602553 TCTGATGGGGGGACGCTGGAAGG - Intergenic
1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG + Exonic
1113750513 13:112773591-112773613 GCGGATGGGGGTCCCAGGAAAGG + Intronic
1114065764 14:19059007-19059029 GCTGTTGCGGGGCCCGGGGAAGG - Intergenic
1114096497 14:19340993-19341015 GCTGTTGCGGGGCCCGGGGAAGG + Intergenic
1118350895 14:64972019-64972041 GCTGATCGGGGACTCCGGGGTGG - Exonic
1119517181 14:75257486-75257508 TCTGAATGGGGGCCCAGGGAGGG + Intronic
1119774077 14:77237751-77237773 ACTGACGGGGGGCCACGGGCAGG + Intronic
1119898316 14:78239217-78239239 GCTGATGGGGGGCTCCCTGGAGG - Intergenic
1121255580 14:92528064-92528086 GCTGCTGGGGGGTCCTGGCAAGG + Intronic
1121324556 14:93012430-93012452 GCTGCTGAGGGGGCCAGGGAAGG + Intronic
1122762848 14:104042674-104042696 GCAGCTTGAGGGCCCCGGGAAGG + Intronic
1122788849 14:104176059-104176081 CCTGAGGGGGGGCCCCTGGAGGG + Exonic
1122793311 14:104193481-104193503 GCAGATGTGGGGCACAGGGATGG - Intergenic
1122796961 14:104210816-104210838 GCAGAAGGGGGCCCCTGGGAGGG + Intergenic
1122855912 14:104559990-104560012 GTTGCTGGGGGGCCCCTGGGTGG - Intronic
1123044157 14:105503275-105503297 GCTGGTGAGGGGCCCGGGGCTGG + Intergenic
1123054143 14:105561303-105561325 CCTGGTGGGGGGACACGGGAGGG - Intergenic
1123078726 14:105681720-105681742 CCTGGTGGGGGGACACGGGAGGG - Intergenic
1123125016 14:105940324-105940346 GCTGATATAAGGCCCCGGGACGG + Intergenic
1202834102 14_GL000009v2_random:65147-65169 GATGGTTGGGGGCACCGGGAGGG + Intergenic
1124014504 15:25863769-25863791 GCTCCTGGGGAGCCCTGGGAAGG + Intronic
1124382239 15:29176698-29176720 GCTGAGGCCGGGCCCCAGGAGGG + Intronic
1125821171 15:42633029-42633051 GCTGCTGGGGGGCCAAGGTAGGG + Intronic
1128940042 15:71780625-71780647 GCTGTTGGGGACCCCAGGGAGGG + Exonic
1129523632 15:76200816-76200838 GTTGAGGGAGGGCCCCGGGCTGG - Intronic
1130532025 15:84754575-84754597 GATGATGGTGGGGCCCGGCATGG + Intronic
1130750375 15:86705136-86705158 GCTGGTGGGGGGCAAGGGGAGGG + Intronic
1131552753 15:93372202-93372224 GCTGCTTGGTGGCCCCTGGAAGG + Intergenic
1132689286 16:1175307-1175329 GGTTCTGGGGAGCCCCGGGAGGG + Intronic
1132689613 16:1176670-1176692 GCTGATGGGGGTCCGGGGGCCGG + Intronic
1133056025 16:3145836-3145858 GCTTAGGGGGGGCCCCGGCCGGG + Intronic
1133232689 16:4373947-4373969 GCTGATGGGGGGTCCAGGAGAGG - Intronic
1133250318 16:4476502-4476524 GCGGAAGGAAGGCCCCGGGAGGG - Intronic
1133264620 16:4575738-4575760 GCTGGTGGTGGGGCCCTGGAGGG - Exonic
1136136189 16:28258356-28258378 GAAGTTGGGGGGCCCTGGGAAGG - Intergenic
1136381430 16:29897865-29897887 GCTGAGGAGGGGCCCAGAGATGG - Exonic
1137362704 16:47833897-47833919 GCTTATTGGGGGCCCCTTGAGGG + Intergenic
1137632700 16:49958114-49958136 GCTGAAGGAGGGACCCAGGAAGG + Intergenic
1137766426 16:50981053-50981075 GCTGGTGCTGGGCCCTGGGATGG + Intergenic
1139946776 16:70647277-70647299 GGTGTTGGGGAGCCCCGGGCGGG + Intronic
1141096492 16:81166485-81166507 GCTGGTGCGGGGACCCAGGAAGG + Intergenic
1141949200 16:87329965-87329987 GCTGGTGAGGGACCTCGGGAAGG - Exonic
1142034301 16:87854152-87854174 GCTGACGGGTGCCACCGGGAGGG + Intronic
1142141294 16:88473887-88473909 GCCGAGGGGGTGCCCAGGGATGG - Intronic
1142335899 16:89489844-89489866 GCCGATTGGGGGCTCCGGGGCGG - Intronic
1142355312 16:89598987-89599009 GCTGATCGGGGGTCTCGGGCTGG + Intergenic
1142355355 16:89599135-89599157 GCTGATCGGGGGTCTCGGGCTGG + Intergenic
1142666378 17:1466100-1466122 GCTGATTGGGGGTGCCAGGAGGG - Intronic
1143472512 17:7184839-7184861 GCTGATGGAGGGCCTCAGGCTGG - Intergenic
1143521500 17:7446796-7446818 GCTGAGGGGCTGCCCCGGGTTGG - Intronic
1143594574 17:7906617-7906639 GCCGATGGGGTCCCTCGGGAGGG + Exonic
1144767642 17:17741380-17741402 GGTGATGGAGGGGCCCGGGAGGG - Intronic
1144783559 17:17819699-17819721 GCTGCTGGGTGTTCCCGGGAGGG + Exonic
1146482561 17:33216735-33216757 GGTGATGGGGAGCCCCAAGAGGG + Intronic
1147694464 17:42340851-42340873 GCTTATGGTGGGCCCTAGGAAGG - Intronic
1147790758 17:43013199-43013221 GCTCATGGGGAGCCTCAGGAGGG + Intronic
1148205326 17:45776107-45776129 GGTGAAGGGGAGCCCAGGGAGGG - Intergenic
1148669930 17:49402848-49402870 GCTGCTGGGAGGCCCTGGGAGGG + Intronic
1149564208 17:57629995-57630017 GCTCATGGGGGCCCCGGGGCAGG - Intronic
1151465404 17:74281788-74281810 GCTGCTGGGGGGCAGAGGGAGGG - Exonic
1151983803 17:77529191-77529213 GCTGTTCCGGGGGCCCGGGAGGG + Intergenic
1152335905 17:79700202-79700224 CCTGCTGGGGGGCCCTGGGCAGG - Intergenic
1152353728 17:79797120-79797142 GCGGGAGGGGGGCCGCGGGAGGG - Intronic
1152736979 17:82001777-82001799 GCTCCTGGGGGAGCCCGGGAAGG - Intronic
1152861235 17:82698069-82698091 GCTGCTGTGGGGACCCGGGGCGG - Intronic
1152908904 17:82985937-82985959 GGTGATGGGAGGACCCAGGAGGG + Intronic
1153480583 18:5543390-5543412 GCGGCTGGCGGGCCGCGGGAGGG - Intronic
1153525614 18:5992201-5992223 CATGATGAGGAGCCCCGGGAGGG + Intronic
1153536452 18:6107281-6107303 GCTGAGGGGTGGGCCTGGGAAGG + Intronic
1155156804 18:23164378-23164400 GCTGATGGCGGGGCCCTGGGAGG - Intronic
1157613541 18:48974283-48974305 GCTGCTGGGGGGCGGTGGGAGGG + Intergenic
1158418198 18:57268569-57268591 GGTGATGGGGGGCTGGGGGAGGG - Intergenic
1158442970 18:57493606-57493628 GCTGGTGGGAAGCCCTGGGAAGG + Intergenic
1159172994 18:64797082-64797104 GCTGTTGGGGGGCACAGAGATGG - Intergenic
1160747666 19:719568-719590 GCTGCTGGGGGTCCCAGGGCAGG - Intronic
1160817900 19:1044700-1044722 GCTGATGTGGGGCACCTGGTGGG + Exonic
1161346360 19:3770590-3770612 GCCGAGGAGGGGGCCCGGGAGGG + Exonic
1161517540 19:4704604-4704626 GCAGATGGGGGCCCCTGGGAGGG + Intronic
1161655142 19:5509716-5509738 GCGGATGGGGTGGCCCAGGAGGG + Intergenic
1161751023 19:6096854-6096876 GATGGTGGGGGACCCTGGGAGGG - Intronic
1161934787 19:7364937-7364959 GCTGATGGGCTGCCCAGGAAGGG + Intronic
1161972452 19:7590326-7590348 GCTGGAGGGGGGCTCGGGGAGGG + Intergenic
1163447596 19:17356364-17356386 GCTGATGTGGGGCCCTGCGTCGG + Intronic
1163632687 19:18425299-18425321 GCTGGTGAGCGGCCCCGGGAGGG - Intronic
1165076521 19:33282617-33282639 GCTGATGAGGGGTCCTGGAAGGG - Intergenic
1165112950 19:33512869-33512891 GCTGATGGGGGTCCCACGGCAGG - Intronic
1165871309 19:38975501-38975523 ACAGCTGGGGCGCCCCGGGAAGG - Intronic
1165925604 19:39324309-39324331 GCTGGTTGGGGGCCCAGGTAGGG - Intergenic
1165941084 19:39415118-39415140 GCGGATGGGAGGCCCTGGAAGGG - Exonic
1166043825 19:40218034-40218056 GCTGCTGGTGGGCCCGGGGGCGG + Exonic
1166054327 19:40279483-40279505 GCTGAAGAGAGGCCCGGGGAGGG + Intronic
1166283616 19:41810546-41810568 GGTGATGGAGGGTCCCGGGGAGG - Intronic
1166409410 19:42546806-42546828 GCTGATGTGGGCTCCTGGGAAGG + Intronic
1166410718 19:42554150-42554172 GGTGACGGAGGGCCCCGGGGTGG + Intronic
1166810011 19:45508931-45508953 GATTATGGGGGGCCAGGGGAGGG - Intronic
1166948595 19:46412147-46412169 GCCGAGGGCGGGCCCCGGGGTGG - Exonic
1167148222 19:47694964-47694986 GCTGGTGAGGGGCCCCAGGCTGG - Exonic
1167442152 19:49514553-49514575 GCTGATGGAGGGTCCTGGCAGGG - Intronic
1168354519 19:55692900-55692922 GCTGAGGCGGGGCCCCAGGGAGG + Intronic
1202638579 1_KI270706v1_random:62545-62567 GATGGTTGGGGGCACCGGGAGGG - Intergenic
925160239 2:1678307-1678329 GGTGATGGGGAGCCATGGGAGGG - Intronic
925422817 2:3725902-3725924 GCTGCTGGGTGGATCCGGGAGGG + Intronic
926135128 2:10331058-10331080 GCAGATGGGAGGCCACGAGATGG - Intronic
927567054 2:24122985-24123007 GCTGATGCAGGTCACCGGGAAGG - Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
931933045 2:67162358-67162380 GCAGATGGAGGGCCAGGGGAGGG + Intergenic
932480020 2:72033476-72033498 GCTGATGGTGGGCGGCGGGGGGG - Intergenic
932492252 2:72129988-72130010 GCTGAGGGGGGTCCCTGTGAGGG - Exonic
932536549 2:72603358-72603380 GGTGCTGGGGGGCCAGGGGAGGG - Intronic
933378747 2:81515982-81516004 GCTGATGGTGGGGCTCGGGCGGG + Intergenic
934068760 2:88364519-88364541 GCTGATGGCTGGCCCCAGGCAGG - Intergenic
936160008 2:110077795-110077817 GCTCCTGGGTGGCCTCGGGATGG - Intergenic
936184656 2:110293558-110293580 GCTCCTGGGTGGCCTCGGGATGG + Intergenic
937896110 2:126977708-126977730 ACAGATGTGGGGACCCGGGAAGG + Intergenic
938088319 2:128416411-128416433 CTTGATGGGGGGGCCCTGGAGGG + Intergenic
938483169 2:131679136-131679158 GCTGTTGCGGGGCCCAGGGAAGG - Intergenic
938921285 2:135997519-135997541 ACTGATGGAGGGCCCAGGCAGGG + Intergenic
941295819 2:163736747-163736769 GGTGCTGGGGGCCCCGGGGAGGG - Intergenic
942455676 2:176136753-176136775 GCTGGTGGGGAGCCCGGCGAGGG + Intergenic
944129795 2:196335429-196335451 GCTGATGGGCAGGCCCTGGAGGG + Intronic
946268469 2:218568892-218568914 GCTGAAGGGGGGACGCGGGTCGG + Exonic
948805940 2:240453471-240453493 GAGGAAGGGGGGCCCCGGGGCGG - Intronic
1168973606 20:1947620-1947642 GCTGATGGAGGGCCTCGAGCTGG + Intergenic
1169949422 20:11026890-11026912 GCTCATATGGGCCCCCGGGAAGG + Intergenic
1171364068 20:24611639-24611661 GCTGAGGAGGGGCTCCTGGAGGG - Intronic
1172491990 20:35346766-35346788 TCTGATGGGAGGCCCTGGTATGG - Intronic
1174356193 20:49999502-49999524 ACTCATGGGGGCCCTCGGGACGG + Intergenic
1174462290 20:50691449-50691471 CCGGCTGGGGGGCCCCAGGAGGG - Exonic
1174522038 20:51139101-51139123 GGTGATAGGGAGCCCCTGGAAGG - Intergenic
1175698243 20:61118587-61118609 GCTGGAGGGAGGCCCTGGGATGG - Intergenic
1176032907 20:63022409-63022431 GCTGAGGGGAGGCCCCTTGAGGG + Intergenic
1176148005 20:63574062-63574084 GCGGAGGGGGGGGTCCGGGAGGG - Intronic
1176202041 20:63865493-63865515 GCTGAAGAGGGGCCGCGGGGTGG - Intronic
1178361407 21:31951529-31951551 TCTCATGGGGGTCCCTGGGATGG + Intronic
1178397294 21:32253584-32253606 GCTGATGGGAGCCCCAGGGAGGG + Intergenic
1178416941 21:32412274-32412296 GCCGATCGGGGGCCGCAGGAAGG - Intronic
1178865101 21:36320415-36320437 GCTGCGGCGGGGCCCGGGGAGGG + Intronic
1178893809 21:36542684-36542706 GCTGCTGGGGGGCCTCTGGGAGG - Intronic
1179921841 21:44511830-44511852 GGTGATGGGGGACCCCGAGCTGG + Intronic
1180363387 22:11919343-11919365 GATGGTTGGGGGCACCGGGAGGG + Intergenic
1180484246 22:15781599-15781621 GCTGTTGCGGGGCCCGGGGAAGG - Intergenic
1180796128 22:18606658-18606680 GCAAATGGGGGGCCAGGGGAAGG - Exonic
1181015640 22:20066894-20066916 GCTGCTGGGGAGCCCTGGGCAGG - Intergenic
1181081028 22:20415247-20415269 GAGGATGGGGGGCTGCGGGAGGG - Intergenic
1181225594 22:21388613-21388635 GCAAATGGGGGGCCAGGGGAAGG + Exonic
1181253040 22:21546200-21546222 GCAAATGGGGGGCCAGGGGAAGG - Exonic
1181640065 22:24191563-24191585 GCTGATCTGGGGGCCAGGGAGGG + Intergenic
1183193581 22:36337505-36337527 GCAGATGGAGGTCCCCAGGAAGG + Intronic
1183585498 22:38750839-38750861 GCTGCTGGGAGGCCTCAGGAAGG - Intronic
1183727700 22:39598577-39598599 GCTGGTGGGGGCACCCGGGTAGG - Intronic
1184044429 22:41963895-41963917 GCTGCTGGGGGGGCCAGGGAAGG - Intergenic
1184102165 22:42346632-42346654 GCTGGTGAGGGGCAACGGGAGGG - Intergenic
1184111440 22:42397932-42397954 GCGGATGCGGGGTCCAGGGAAGG - Exonic
1184197379 22:42939080-42939102 GCTGATGGGCTGCGCTGGGACGG - Intronic
1184455868 22:44609144-44609166 GGAGTTGGGGGGCTCCGGGAAGG + Intergenic
1185291710 22:50030738-50030760 GGTGATGGGGGTCCCTGGGCAGG + Exonic
950031918 3:9859374-9859396 GCAGATGGGGTGCTCAGGGAGGG - Intergenic
950053817 3:10010480-10010502 GCAGATGGGGTGCTCAGGGAGGG - Intronic
950189245 3:10965295-10965317 GCTGATGGGAGGCCCTGGCAGGG + Intergenic
950415605 3:12867452-12867474 GCAGATGGGGTGCTCAGGGAGGG - Intronic
950417199 3:12875508-12875530 GCGGATGGGGTGCTCAGGGAGGG - Intergenic
953484942 3:43286481-43286503 GCTGGGGCGGGGCCGCGGGAAGG - Intergenic
955998295 3:64700764-64700786 GCTGATTGGGGGCCCCACTAGGG + Intergenic
958980130 3:100709997-100710019 GCGCCTGGGGGGCTCCGGGAGGG + Intronic
961477261 3:127156736-127156758 GCTGGTGGAGGGCCACAGGAGGG - Intergenic
961550591 3:127668611-127668633 GGTGATGGGAGGGCCCAGGAGGG + Intronic
961713132 3:128842287-128842309 GCAGATGGGGTGCTCAGGGAGGG + Intergenic
961783974 3:129338382-129338404 GCAGATGGGGTGCTCAGGGAGGG - Intergenic
961785223 3:129343458-129343480 GCAGATGGGGTGCTCAGGGAGGG - Intergenic
961818052 3:129561412-129561434 GCTGGAGAGAGGCCCCGGGAGGG - Intronic
961893200 3:130147267-130147289 AGGGAAGGGGGGCCCCGGGAAGG - Intergenic
964551479 3:157889843-157889865 TCTGATGTGGGTCCCCAGGATGG - Intergenic
969301284 4:6298912-6298934 GCTGATGGGGGGCTCCAGCCTGG + Intronic
976629174 4:87219967-87219989 GCGGGTTCGGGGCCCCGGGAGGG - Intronic
979145367 4:117239990-117240012 GCTCATGGGTGGCCCTGGGTGGG - Intergenic
979551331 4:121994440-121994462 GCTGATGGGAAGCCATGGGATGG + Intergenic
981315352 4:143336045-143336067 GCCGATTGGGGGCCGCCGGACGG + Intergenic
1202765918 4_GL000008v2_random:148404-148426 GATGGTTGGGGGCACCGGGAGGG - Intergenic
985566859 5:623296-623318 GGAGGTGCGGGGCCCCGGGACGG + Intronic
985759008 5:1735169-1735191 AGAGATGGGGGGCCCAGGGAGGG + Intergenic
986295538 5:6434839-6434861 CCTGATGCGGGGCTCAGGGAAGG - Intergenic
988061982 5:26183185-26183207 GGGGATGGGGGGCAACGGGAGGG - Intergenic
991090538 5:62689982-62690004 GCTGCCAGGGGGCCCCGGGAGGG + Intergenic
992895220 5:81239711-81239733 CCTGTTGGGGGGTCCTGGGAGGG - Intronic
993699558 5:91102009-91102031 GCTGCTGGTAGGCCCAGGGATGG - Intronic
994001808 5:94790288-94790310 GCCAATGGGAGGCCCAGGGAAGG + Intronic
995015271 5:107302515-107302537 GCTGATGGGGTGACCCAGGGTGG + Intergenic
997277009 5:132601979-132602001 GCTGGTGGGGGGCTAGGGGAGGG + Intronic
998597151 5:143543906-143543928 GATGATGGGAGGCCGCAGGATGG + Intergenic
999147684 5:149406782-149406804 GCCAATGGGGGGCCCTGGGAGGG + Intergenic
999244199 5:150144695-150144717 GCTGCTGGGGGCCCAAGGGAGGG + Intronic
999859919 5:155633863-155633885 GCTCATGGGTGGCCACGGGCAGG - Intergenic
1001035150 5:168292007-168292029 GCAGATGGGGGGCCCTAGTAGGG - Intronic
1001070292 5:168579522-168579544 GCTGCGGGGGGGCCCCGGAGCGG - Exonic
1003098669 6:3160616-3160638 GCTGTTGGGTGGGCCGGGGATGG + Intergenic
1003957154 6:11174541-11174563 GATGATGAGGAGCCCGGGGAAGG - Intergenic
1005009259 6:21320647-21320669 GGTGGTGGGGGGCTCGGGGAGGG + Intergenic
1006027718 6:31158103-31158125 GCTGAGCGGGGGTCCTGGGAGGG - Intronic
1006114810 6:31769922-31769944 GGTGGTGGGGAGCCCCAGGAGGG + Intronic
1006474311 6:34244969-34244991 GGTGATGGTGGGCCTGGGGAAGG - Exonic
1006717714 6:36130824-36130846 GCCGCTGGGTGGCCCCGGGGAGG - Intronic
1006720296 6:36145673-36145695 GCTGCTGGGTGTGCCCGGGAAGG + Intergenic
1006797468 6:36741016-36741038 GCAGCTGGGTGGGCCCGGGAGGG + Exonic
1007825161 6:44594758-44594780 GCTGCTGGCTGGCCCCAGGACGG - Intergenic
1009430328 6:63558818-63558840 TCTTATGGGGGCCCCTGGGATGG - Intronic
1013621699 6:111896567-111896589 GCTGATGGGTGGGCCAGGGTTGG - Intergenic
1014265243 6:119269500-119269522 GCAGATGGGGGGCCTCAGGAAGG + Intronic
1017084095 6:150697557-150697579 GCTGAGGGCCGGCCCTGGGAGGG + Intronic
1018735035 6:166681527-166681549 GCTGATCGGTGGCCCCAGGAAGG + Intronic
1019586755 7:1809229-1809251 CCAGATGGGTGGCCCCAGGAAGG + Intergenic
1020106156 7:5423262-5423284 GGGGAGGGGGCGCCCCGGGAGGG - Intronic
1022533606 7:31082192-31082214 GCTGATGGGCTGATCCGGGACGG + Intronic
1023292040 7:38678649-38678671 GCTGATGGGGGGCACACAGAGGG + Intergenic
1023922430 7:44639860-44639882 GCTGCTGGGAATCCCCGGGAAGG - Intronic
1026740208 7:72974415-72974437 GCTTAAGGGGGGCCCAAGGAGGG + Intergenic
1027103525 7:75390655-75390677 GCTTAAGGGGGGCCCAAGGAGGG - Intergenic
1029280639 7:99433316-99433338 GCTGATTGGGGGCTGCGGGCGGG - Exonic
1029419780 7:100466694-100466716 ACTGCTGGGGGGTCCCAGGAGGG + Exonic
1029437748 7:100572480-100572502 GCAGTGGAGGGGCCCCGGGAGGG + Exonic
1029484083 7:100828740-100828762 GCTCCTGGGGGCCCTCGGGATGG + Intronic
1032382942 7:131503239-131503261 GCTGATGGGGGGCCCCGGGAAGG + Intronic
1033051399 7:138007472-138007494 GCCGAGGGGTGGCCCTGGGAGGG - Intronic
1033622020 7:143070123-143070145 GCTGATGGTGTGCCCCAGCAGGG + Intergenic
1034436947 7:151066963-151066985 GCTTGTGGGGGGCCCGGGGTCGG - Exonic
1037626500 8:20611962-20611984 GCGGATTGGGGGCTCGGGGAGGG - Intergenic
1037815627 8:22110183-22110205 GCAGATGGTGCGCCCTGGGAGGG + Intergenic
1037907681 8:22725042-22725064 GCTGATCTGGGGCCCCAGGGAGG - Intronic
1039212700 8:35235369-35235391 GCTGGGGCGGGGCCGCGGGAGGG - Intergenic
1039630550 8:39107547-39107569 GCGGCTGGGGTGCGCCGGGAAGG + Intronic
1039921405 8:41896615-41896637 GCTGCTGCGGGGTCGCGGGAAGG + Exonic
1042533157 8:69834520-69834542 GCTGGTGGGGTTCCCCGGGAAGG - Intronic
1042812170 8:72838255-72838277 GCTGGTGGGGGGCTGGGGGAAGG - Intronic
1042946732 8:74162482-74162504 GGTGGTGGGGGGCTGCGGGAGGG + Intergenic
1043552637 8:81392087-81392109 GGTGATGGGGGGCAAGGGGAGGG + Intergenic
1045277634 8:100721850-100721872 GCTGCTGCGGGGCCGCGGGCGGG + Exonic
1045322357 8:101091691-101091713 GCTGATGTGGGGGCCAGGAAGGG - Intergenic
1047386641 8:124416143-124416165 GCTCTTGGTGGGCCCCTGGATGG + Intergenic
1049014607 8:139910774-139910796 GCTGAGGGGGGGCTGTGGGAGGG - Intronic
1049774654 8:144398742-144398764 GCTGCAGGGAGGCCCTGGGATGG - Intronic
1049790116 8:144468565-144468587 GCTGCTGGAGGGCCCCTTGAAGG - Exonic
1049824003 8:144655250-144655272 GCTGATGGGTGGCCATGGGTGGG - Intergenic
1051366572 9:16325555-16325577 GCAGATGGCGGGTCCAGGGAGGG - Intergenic
1057724249 9:97556939-97556961 GCTGATGGGAGGAGCCTGGAGGG + Intronic
1058919588 9:109600236-109600258 GCTGATGGGAGGCACAGGCAGGG + Intergenic
1059339066 9:113587218-113587240 GCTGATGAGGGGCCGGGGGTGGG + Intronic
1061482160 9:130902682-130902704 CCTGATGGGGGGCCTCCGAAAGG - Exonic
1062395117 9:136349689-136349711 GCTGAGAGGAGGCCCCGGGAGGG + Exonic
1203546669 Un_KI270743v1:133293-133315 GATGGTTGGGGGCACCGGGAGGG - Intergenic
1185567733 X:1108597-1108619 GCTGGTTTGGGGCCCAGGGAGGG + Intergenic
1188156424 X:26748440-26748462 GGTGATGGTGGGCCTGGGGAAGG - Intergenic
1189702048 X:43721830-43721852 GGGGATGGGGGGCTCAGGGAGGG - Intronic
1192175883 X:68885216-68885238 GCTGATTGGGGCCCCTGGGCTGG - Intergenic
1192640654 X:72859110-72859132 GCGGGTGGGGGGCTACGGGAGGG + Intergenic
1192641057 X:72861666-72861688 GCGGGTGGGGGGCTACGGGAGGG - Intergenic
1195140669 X:101956160-101956182 GGGGATGGGGGGCAACGGGAGGG + Intergenic
1197831341 X:130646382-130646404 GCTGAAGCTGGGCCCCAGGAGGG - Intronic
1201672412 Y:16538819-16538841 GGGGATGGGGGGCCAAGGGAGGG - Intergenic
1201904637 Y:19076764-19076786 GCGGACGGGGGGCTCCGGGGCGG - Intergenic