ID: 1032389677

View in Genome Browser
Species Human (GRCh38)
Location 7:131547800-131547822
Sequence CTCCACGGAATACCACCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032389670_1032389677 -1 Left 1032389670 7:131547778-131547800 CCCTCAGTGGCCCCCAAGGCAGC 0: 1
1: 0
2: 1
3: 27
4: 220
Right 1032389677 7:131547800-131547822 CTCCACGGAATACCACCCGCAGG No data
1032389663_1032389677 22 Left 1032389663 7:131547755-131547777 CCTCTCCAGGTATGCACCCCAAG 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1032389677 7:131547800-131547822 CTCCACGGAATACCACCCGCAGG No data
1032389668_1032389677 4 Left 1032389668 7:131547773-131547795 CCAAGCCCTCAGTGGCCCCCAAG 0: 1
1: 0
2: 4
3: 30
4: 337
Right 1032389677 7:131547800-131547822 CTCCACGGAATACCACCCGCAGG No data
1032389671_1032389677 -2 Left 1032389671 7:131547779-131547801 CCTCAGTGGCCCCCAAGGCAGCT 0: 1
1: 0
2: 5
3: 28
4: 308
Right 1032389677 7:131547800-131547822 CTCCACGGAATACCACCCGCAGG No data
1032389664_1032389677 17 Left 1032389664 7:131547760-131547782 CCAGGTATGCACCCCAAGCCCTC 0: 1
1: 0
2: 2
3: 7
4: 141
Right 1032389677 7:131547800-131547822 CTCCACGGAATACCACCCGCAGG No data
1032389667_1032389677 5 Left 1032389667 7:131547772-131547794 CCCAAGCCCTCAGTGGCCCCCAA 0: 1
1: 0
2: 2
3: 30
4: 297
Right 1032389677 7:131547800-131547822 CTCCACGGAATACCACCCGCAGG No data
1032389666_1032389677 6 Left 1032389666 7:131547771-131547793 CCCCAAGCCCTCAGTGGCCCCCA 0: 1
1: 0
2: 4
3: 37
4: 404
Right 1032389677 7:131547800-131547822 CTCCACGGAATACCACCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032389677 Original CRISPR CTCCACGGAATACCACCCGC AGG Intronic
No off target data available for this crispr