ID: 1032392333

View in Genome Browser
Species Human (GRCh38)
Location 7:131563609-131563631
Sequence GGTCCCAAGGGCCCACGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032392333_1032392339 6 Left 1032392333 7:131563609-131563631 CCTGAACGTGGGCCCTTGGGACC No data
Right 1032392339 7:131563638-131563660 AGCACCTAAGAGAGAGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032392333 Original CRISPR GGTCCCAAGGGCCCACGTTC AGG (reversed) Intergenic
No off target data available for this crispr