ID: 1032394201

View in Genome Browser
Species Human (GRCh38)
Location 7:131577458-131577480
Sequence GACACTGATGTCCAAAGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032394198_1032394201 24 Left 1032394198 7:131577411-131577433 CCGGCCAAAGTCACTTAATTCTT No data
Right 1032394201 7:131577458-131577480 GACACTGATGTCCAAAGAGGCGG No data
1032394199_1032394201 20 Left 1032394199 7:131577415-131577437 CCAAAGTCACTTAATTCTTACAG No data
Right 1032394201 7:131577458-131577480 GACACTGATGTCCAAAGAGGCGG No data
1032394197_1032394201 30 Left 1032394197 7:131577405-131577427 CCGCGTCCGGCCAAAGTCACTTA No data
Right 1032394201 7:131577458-131577480 GACACTGATGTCCAAAGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032394201 Original CRISPR GACACTGATGTCCAAAGAGG CGG Intergenic
No off target data available for this crispr