ID: 1032394678

View in Genome Browser
Species Human (GRCh38)
Location 7:131581126-131581148
Sequence CTTTGTTGCTGGCATCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032394678_1032394685 2 Left 1032394678 7:131581126-131581148 CCCCCAGGATGCCAGCAACAAAG No data
Right 1032394685 7:131581151-131581173 TATCCTATGGTAGAAAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032394678 Original CRISPR CTTTGTTGCTGGCATCCTGG GGG (reversed) Intergenic