ID: 1032398326

View in Genome Browser
Species Human (GRCh38)
Location 7:131606696-131606718
Sequence CCCTGCAAGGCCCTTTGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032398311_1032398326 28 Left 1032398311 7:131606645-131606667 CCAAAGGCCCCGCCGCAGCCAGG No data
Right 1032398326 7:131606696-131606718 CCCTGCAAGGCCCTTTGATGTGG No data
1032398317_1032398326 16 Left 1032398317 7:131606657-131606679 CCGCAGCCAGGGTGTCCTCCTCC No data
Right 1032398326 7:131606696-131606718 CCCTGCAAGGCCCTTTGATGTGG No data
1032398319_1032398326 1 Left 1032398319 7:131606672-131606694 CCTCCTCCCAGCCTCTACAACTC No data
Right 1032398326 7:131606696-131606718 CCCTGCAAGGCCCTTTGATGTGG No data
1032398315_1032398326 20 Left 1032398315 7:131606653-131606675 CCCGCCGCAGCCAGGGTGTCCTC No data
Right 1032398326 7:131606696-131606718 CCCTGCAAGGCCCTTTGATGTGG No data
1032398318_1032398326 10 Left 1032398318 7:131606663-131606685 CCAGGGTGTCCTCCTCCCAGCCT No data
Right 1032398326 7:131606696-131606718 CCCTGCAAGGCCCTTTGATGTGG No data
1032398323_1032398326 -10 Left 1032398323 7:131606683-131606705 CCTCTACAACTCACCCTGCAAGG No data
Right 1032398326 7:131606696-131606718 CCCTGCAAGGCCCTTTGATGTGG No data
1032398316_1032398326 19 Left 1032398316 7:131606654-131606676 CCGCCGCAGCCAGGGTGTCCTCC No data
Right 1032398326 7:131606696-131606718 CCCTGCAAGGCCCTTTGATGTGG No data
1032398321_1032398326 -5 Left 1032398321 7:131606678-131606700 CCCAGCCTCTACAACTCACCCTG No data
Right 1032398326 7:131606696-131606718 CCCTGCAAGGCCCTTTGATGTGG No data
1032398314_1032398326 21 Left 1032398314 7:131606652-131606674 CCCCGCCGCAGCCAGGGTGTCCT No data
Right 1032398326 7:131606696-131606718 CCCTGCAAGGCCCTTTGATGTGG No data
1032398322_1032398326 -6 Left 1032398322 7:131606679-131606701 CCAGCCTCTACAACTCACCCTGC No data
Right 1032398326 7:131606696-131606718 CCCTGCAAGGCCCTTTGATGTGG No data
1032398320_1032398326 -2 Left 1032398320 7:131606675-131606697 CCTCCCAGCCTCTACAACTCACC No data
Right 1032398326 7:131606696-131606718 CCCTGCAAGGCCCTTTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032398326 Original CRISPR CCCTGCAAGGCCCTTTGATG TGG Intergenic
No off target data available for this crispr