ID: 1032401691

View in Genome Browser
Species Human (GRCh38)
Location 7:131628730-131628752
Sequence CTCCAGTTCAGGGCCTTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032401679_1032401691 8 Left 1032401679 7:131628699-131628721 CCAACATGCCCTCCAAGGACCCC No data
Right 1032401691 7:131628730-131628752 CTCCAGTTCAGGGCCTTCTTGGG No data
1032401683_1032401691 -4 Left 1032401683 7:131628711-131628733 CCAAGGACCCCATTCTGGCCTCC No data
Right 1032401691 7:131628730-131628752 CTCCAGTTCAGGGCCTTCTTGGG No data
1032401682_1032401691 -1 Left 1032401682 7:131628708-131628730 CCTCCAAGGACCCCATTCTGGCC No data
Right 1032401691 7:131628730-131628752 CTCCAGTTCAGGGCCTTCTTGGG No data
1032401681_1032401691 0 Left 1032401681 7:131628707-131628729 CCCTCCAAGGACCCCATTCTGGC No data
Right 1032401691 7:131628730-131628752 CTCCAGTTCAGGGCCTTCTTGGG No data
1032401677_1032401691 28 Left 1032401677 7:131628679-131628701 CCGGAGATGGGGCTGACTTGCCA No data
Right 1032401691 7:131628730-131628752 CTCCAGTTCAGGGCCTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032401691 Original CRISPR CTCCAGTTCAGGGCCTTCTT GGG Intergenic