ID: 1032403307

View in Genome Browser
Species Human (GRCh38)
Location 7:131638491-131638513
Sequence AGCGTCTACTAGGTGGATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032403299_1032403307 6 Left 1032403299 7:131638462-131638484 CCAGTCTTGGGTGGAAAACCCAA No data
Right 1032403307 7:131638491-131638513 AGCGTCTACTAGGTGGATTAGGG No data
1032403295_1032403307 23 Left 1032403295 7:131638445-131638467 CCACAGTCAGGTCTTGGCCAGTC No data
Right 1032403307 7:131638491-131638513 AGCGTCTACTAGGTGGATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032403307 Original CRISPR AGCGTCTACTAGGTGGATTA GGG Intergenic
No off target data available for this crispr