ID: 1032408536

View in Genome Browser
Species Human (GRCh38)
Location 7:131675437-131675459
Sequence ACAAGTATAGACTCACTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032408536_1032408538 20 Left 1032408536 7:131675437-131675459 CCATCCAGTGAGTCTATACTTGT No data
Right 1032408538 7:131675480-131675502 CAGAACAGTTTCCCAAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032408536 Original CRISPR ACAAGTATAGACTCACTGGA TGG (reversed) Intergenic
No off target data available for this crispr