ID: 1032408537 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:131675441-131675463 |
| Sequence | GAGAACAAGTATAGACTCAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1032408537_1032408538 | 16 | Left | 1032408537 | 7:131675441-131675463 | CCAGTGAGTCTATACTTGTTCTC | No data | ||
| Right | 1032408538 | 7:131675480-131675502 | CAGAACAGTTTCCCAAGTCTTGG | No data | ||||
| 1032408537_1032408541 | 29 | Left | 1032408537 | 7:131675441-131675463 | CCAGTGAGTCTATACTTGTTCTC | No data | ||
| Right | 1032408541 | 7:131675493-131675515 | CAAGTCTTGGTGTATCTTTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1032408537 | Original CRISPR | GAGAACAAGTATAGACTCAC TGG (reversed) | Intergenic | ||