ID: 1032408537

View in Genome Browser
Species Human (GRCh38)
Location 7:131675441-131675463
Sequence GAGAACAAGTATAGACTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032408537_1032408541 29 Left 1032408537 7:131675441-131675463 CCAGTGAGTCTATACTTGTTCTC No data
Right 1032408541 7:131675493-131675515 CAAGTCTTGGTGTATCTTTCTGG No data
1032408537_1032408538 16 Left 1032408537 7:131675441-131675463 CCAGTGAGTCTATACTTGTTCTC No data
Right 1032408538 7:131675480-131675502 CAGAACAGTTTCCCAAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032408537 Original CRISPR GAGAACAAGTATAGACTCAC TGG (reversed) Intergenic