ID: 1032408538 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:131675480-131675502 |
Sequence | CAGAACAGTTTCCCAAGTCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1032408536_1032408538 | 20 | Left | 1032408536 | 7:131675437-131675459 | CCATCCAGTGAGTCTATACTTGT | No data | ||
Right | 1032408538 | 7:131675480-131675502 | CAGAACAGTTTCCCAAGTCTTGG | No data | ||||
1032408537_1032408538 | 16 | Left | 1032408537 | 7:131675441-131675463 | CCAGTGAGTCTATACTTGTTCTC | No data | ||
Right | 1032408538 | 7:131675480-131675502 | CAGAACAGTTTCCCAAGTCTTGG | No data | ||||
1032408535_1032408538 | 29 | Left | 1032408535 | 7:131675428-131675450 | CCTGTCTGACCATCCAGTGAGTC | No data | ||
Right | 1032408538 | 7:131675480-131675502 | CAGAACAGTTTCCCAAGTCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1032408538 | Original CRISPR | CAGAACAGTTTCCCAAGTCT TGG | Intergenic | ||