ID: 1032408538

View in Genome Browser
Species Human (GRCh38)
Location 7:131675480-131675502
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032408536_1032408538 20 Left 1032408536 7:131675437-131675459 CCATCCAGTGAGTCTATACTTGT No data
Right 1032408538 7:131675480-131675502 CAGAACAGTTTCCCAAGTCTTGG No data
1032408537_1032408538 16 Left 1032408537 7:131675441-131675463 CCAGTGAGTCTATACTTGTTCTC No data
Right 1032408538 7:131675480-131675502 CAGAACAGTTTCCCAAGTCTTGG No data
1032408535_1032408538 29 Left 1032408535 7:131675428-131675450 CCTGTCTGACCATCCAGTGAGTC No data
Right 1032408538 7:131675480-131675502 CAGAACAGTTTCCCAAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032408538 Original CRISPR CAGAACAGTTTCCCAAGTCT TGG Intergenic