ID: 1032408541

View in Genome Browser
Species Human (GRCh38)
Location 7:131675493-131675515
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032408537_1032408541 29 Left 1032408537 7:131675441-131675463 CCAGTGAGTCTATACTTGTTCTC No data
Right 1032408541 7:131675493-131675515 CAAGTCTTGGTGTATCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032408541 Original CRISPR CAAGTCTTGGTGTATCTTTC TGG Intergenic