ID: 1032415495

View in Genome Browser
Species Human (GRCh38)
Location 7:131732537-131732559
Sequence TGGCTGGAGCAGAGGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032415495_1032415505 4 Left 1032415495 7:131732537-131732559 CCCAGCTCCCTCTGCTCCAGCCA No data
Right 1032415505 7:131732564-131732586 GGCCTCTTGCTGTTCCTTGGAGG No data
1032415495_1032415508 28 Left 1032415495 7:131732537-131732559 CCCAGCTCCCTCTGCTCCAGCCA No data
Right 1032415508 7:131732588-131732610 GCCAAGCACTTTCCCACCTCCGG No data
1032415495_1032415504 1 Left 1032415495 7:131732537-131732559 CCCAGCTCCCTCTGCTCCAGCCA No data
Right 1032415504 7:131732561-131732583 CAGGGCCTCTTGCTGTTCCTTGG No data
1032415495_1032415510 29 Left 1032415495 7:131732537-131732559 CCCAGCTCCCTCTGCTCCAGCCA No data
Right 1032415510 7:131732589-131732611 CCAAGCACTTTCCCACCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032415495 Original CRISPR TGGCTGGAGCAGAGGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr