ID: 1032420639

View in Genome Browser
Species Human (GRCh38)
Location 7:131776281-131776303
Sequence GGTCCCACCATTGCAGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032420632_1032420639 12 Left 1032420632 7:131776246-131776268 CCTGCAGCTCTAACCTGAGCCCT No data
Right 1032420639 7:131776281-131776303 GGTCCCACCATTGCAGTAGGAGG No data
1032420635_1032420639 -7 Left 1032420635 7:131776265-131776287 CCCTAAGCCACATCTCGGTCCCA No data
Right 1032420639 7:131776281-131776303 GGTCCCACCATTGCAGTAGGAGG No data
1032420633_1032420639 -1 Left 1032420633 7:131776259-131776281 CCTGAGCCCTAAGCCACATCTCG No data
Right 1032420639 7:131776281-131776303 GGTCCCACCATTGCAGTAGGAGG No data
1032420631_1032420639 20 Left 1032420631 7:131776238-131776260 CCTGGCAGCCTGCAGCTCTAACC No data
Right 1032420639 7:131776281-131776303 GGTCCCACCATTGCAGTAGGAGG No data
1032420636_1032420639 -8 Left 1032420636 7:131776266-131776288 CCTAAGCCACATCTCGGTCCCAC No data
Right 1032420639 7:131776281-131776303 GGTCCCACCATTGCAGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032420639 Original CRISPR GGTCCCACCATTGCAGTAGG AGG Intergenic
No off target data available for this crispr