ID: 1032421488

View in Genome Browser
Species Human (GRCh38)
Location 7:131783272-131783294
Sequence CCAGGCCATTGTACCATTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032421488_1032421493 -5 Left 1032421488 7:131783272-131783294 CCATAAATGGTACAATGGCCTGG No data
Right 1032421493 7:131783290-131783312 CCTGGTCTGAAGTGGGTTTTAGG No data
1032421488_1032421496 22 Left 1032421488 7:131783272-131783294 CCATAAATGGTACAATGGCCTGG No data
Right 1032421496 7:131783317-131783339 CCCCTTTCACAGAACTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032421488 Original CRISPR CCAGGCCATTGTACCATTTA TGG (reversed) Intergenic
No off target data available for this crispr