ID: 1032422952

View in Genome Browser
Species Human (GRCh38)
Location 7:131797863-131797885
Sequence CATCCACTAGGTTTATGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032422945_1032422952 15 Left 1032422945 7:131797825-131797847 CCCCATAAAGTATATAAAGTAAG No data
Right 1032422952 7:131797863-131797885 CATCCACTAGGTTTATGGACAGG No data
1032422946_1032422952 14 Left 1032422946 7:131797826-131797848 CCCATAAAGTATATAAAGTAAGT No data
Right 1032422952 7:131797863-131797885 CATCCACTAGGTTTATGGACAGG No data
1032422947_1032422952 13 Left 1032422947 7:131797827-131797849 CCATAAAGTATATAAAGTAAGTT No data
Right 1032422952 7:131797863-131797885 CATCCACTAGGTTTATGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032422952 Original CRISPR CATCCACTAGGTTTATGGAC AGG Intergenic
No off target data available for this crispr