ID: 1032425124

View in Genome Browser
Species Human (GRCh38)
Location 7:131816443-131816465
Sequence CTGTGTAAACACATGTGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032425119_1032425124 8 Left 1032425119 7:131816412-131816434 CCATGTTTCTTGGACATGATGCA No data
Right 1032425124 7:131816443-131816465 CTGTGTAAACACATGTGTATGGG No data
1032425117_1032425124 21 Left 1032425117 7:131816399-131816421 CCAAAGTTATTTTCCATGTTTCT No data
Right 1032425124 7:131816443-131816465 CTGTGTAAACACATGTGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032425124 Original CRISPR CTGTGTAAACACATGTGTAT GGG Intergenic
No off target data available for this crispr