ID: 1032428181

View in Genome Browser
Species Human (GRCh38)
Location 7:131838490-131838512
Sequence AATCTGGGGCTTCCATAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032428172_1032428181 21 Left 1032428172 7:131838446-131838468 CCTTAGGAGATGATGCAAAGAAT No data
Right 1032428181 7:131838490-131838512 AATCTGGGGCTTCCATAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032428181 Original CRISPR AATCTGGGGCTTCCATAGCT GGG Intergenic
No off target data available for this crispr