ID: 1032429153

View in Genome Browser
Species Human (GRCh38)
Location 7:131846916-131846938
Sequence GATGGAGGGAAGCGCATTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032429145_1032429153 19 Left 1032429145 7:131846874-131846896 CCAGTTGACACAGGAGTAATGAG No data
Right 1032429153 7:131846916-131846938 GATGGAGGGAAGCGCATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032429153 Original CRISPR GATGGAGGGAAGCGCATTCC AGG Intergenic
No off target data available for this crispr