ID: 1032431825

View in Genome Browser
Species Human (GRCh38)
Location 7:131868290-131868312
Sequence GAGAAGAAGGAGCAGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032431812_1032431825 20 Left 1032431812 7:131868247-131868269 CCAGCTCCAAGACAGAAAGGTAG No data
Right 1032431825 7:131868290-131868312 GAGAAGAAGGAGCAGGTGAAAGG No data
1032431816_1032431825 14 Left 1032431816 7:131868253-131868275 CCAAGACAGAAAGGTAGGGGAAA No data
Right 1032431825 7:131868290-131868312 GAGAAGAAGGAGCAGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032431825 Original CRISPR GAGAAGAAGGAGCAGGTGAA AGG Intergenic
No off target data available for this crispr