ID: 1032432760

View in Genome Browser
Species Human (GRCh38)
Location 7:131875358-131875380
Sequence GAGGTTAAGCATAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032432760_1032432765 7 Left 1032432760 7:131875358-131875380 CCTTCCTCCTTATGCTTAACCTC No data
Right 1032432765 7:131875388-131875410 CTCAGTTTCCTCATCTACAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032432760 Original CRISPR GAGGTTAAGCATAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr