ID: 1032433369

View in Genome Browser
Species Human (GRCh38)
Location 7:131880752-131880774
Sequence TGGCCTCCAAGGGAGCTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032433369_1032433374 -2 Left 1032433369 7:131880752-131880774 CCTTTCAGCTCCCTTGGAGGCCA No data
Right 1032433374 7:131880773-131880795 CAGGATGTTCTTCTTGTACCTGG No data
1032433369_1032433375 6 Left 1032433369 7:131880752-131880774 CCTTTCAGCTCCCTTGGAGGCCA No data
Right 1032433375 7:131880781-131880803 TCTTCTTGTACCTGGATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032433369 Original CRISPR TGGCCTCCAAGGGAGCTGAA AGG (reversed) Intergenic
No off target data available for this crispr