ID: 1032435661

View in Genome Browser
Species Human (GRCh38)
Location 7:131898355-131898377
Sequence CAGTTGTACAAGAGGGTAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032435653_1032435661 8 Left 1032435653 7:131898324-131898346 CCTCGGCGGTGTCCACTGTAGGG No data
Right 1032435661 7:131898355-131898377 CAGTTGTACAAGAGGGTAGGCGG No data
1032435651_1032435661 9 Left 1032435651 7:131898323-131898345 CCCTCGGCGGTGTCCACTGTAGG No data
Right 1032435661 7:131898355-131898377 CAGTTGTACAAGAGGGTAGGCGG No data
1032435656_1032435661 -4 Left 1032435656 7:131898336-131898358 CCACTGTAGGGGCACCGTGCAGT No data
Right 1032435661 7:131898355-131898377 CAGTTGTACAAGAGGGTAGGCGG No data
1032435650_1032435661 20 Left 1032435650 7:131898312-131898334 CCATCTGTGTTCCCTCGGCGGTG No data
Right 1032435661 7:131898355-131898377 CAGTTGTACAAGAGGGTAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032435661 Original CRISPR CAGTTGTACAAGAGGGTAGG CGG Intergenic
No off target data available for this crispr