ID: 1032436220

View in Genome Browser
Species Human (GRCh38)
Location 7:131902399-131902421
Sequence CAGGCTACTTCCACTCATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032436220_1032436224 3 Left 1032436220 7:131902399-131902421 CCACTATGAGTGGAAGTAGCCTG No data
Right 1032436224 7:131902425-131902447 CCCTCACCAGAAGCAGATGCTGG 0: 224
1: 625
2: 843
3: 741
4: 698

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032436220 Original CRISPR CAGGCTACTTCCACTCATAG TGG (reversed) Intergenic
No off target data available for this crispr