ID: 1032436931

View in Genome Browser
Species Human (GRCh38)
Location 7:131908479-131908501
Sequence GCCTTCAAGTTTGATGCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032436931_1032436934 -5 Left 1032436931 7:131908479-131908501 CCAAAAGCATCAAACTTGAAGGC No data
Right 1032436934 7:131908497-131908519 AAGGCCAGTAATACCCCAAGGGG No data
1032436931_1032436933 -6 Left 1032436931 7:131908479-131908501 CCAAAAGCATCAAACTTGAAGGC No data
Right 1032436933 7:131908496-131908518 GAAGGCCAGTAATACCCCAAGGG No data
1032436931_1032436936 0 Left 1032436931 7:131908479-131908501 CCAAAAGCATCAAACTTGAAGGC No data
Right 1032436936 7:131908502-131908524 CAGTAATACCCCAAGGGGCAAGG No data
1032436931_1032436932 -7 Left 1032436931 7:131908479-131908501 CCAAAAGCATCAAACTTGAAGGC No data
Right 1032436932 7:131908495-131908517 TGAAGGCCAGTAATACCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032436931 Original CRISPR GCCTTCAAGTTTGATGCTTT TGG (reversed) Intergenic
No off target data available for this crispr