ID: 1032436936

View in Genome Browser
Species Human (GRCh38)
Location 7:131908502-131908524
Sequence CAGTAATACCCCAAGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032436931_1032436936 0 Left 1032436931 7:131908479-131908501 CCAAAAGCATCAAACTTGAAGGC No data
Right 1032436936 7:131908502-131908524 CAGTAATACCCCAAGGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032436936 Original CRISPR CAGTAATACCCCAAGGGGCA AGG Intergenic
No off target data available for this crispr