ID: 1032438446

View in Genome Browser
Species Human (GRCh38)
Location 7:131921656-131921678
Sequence GGAGGAAGAGCTACCTGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032438446_1032438452 12 Left 1032438446 7:131921656-131921678 CCTTTTCAGGTAGCTCTTCCTCC No data
Right 1032438452 7:131921691-131921713 GGAAGTATATGTGTCGGAAGAGG No data
1032438446_1032438451 6 Left 1032438446 7:131921656-131921678 CCTTTTCAGGTAGCTCTTCCTCC No data
Right 1032438451 7:131921685-131921707 GTTTCAGGAAGTATATGTGTCGG No data
1032438446_1032438447 -9 Left 1032438446 7:131921656-131921678 CCTTTTCAGGTAGCTCTTCCTCC No data
Right 1032438447 7:131921670-131921692 TCTTCCTCCCTCTCTGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032438446 Original CRISPR GGAGGAAGAGCTACCTGAAA AGG (reversed) Intergenic