ID: 1032438447

View in Genome Browser
Species Human (GRCh38)
Location 7:131921670-131921692
Sequence TCTTCCTCCCTCTCTGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032438444_1032438447 13 Left 1032438444 7:131921634-131921656 CCACGTCACACTGCGGAGGAGAC No data
Right 1032438447 7:131921670-131921692 TCTTCCTCCCTCTCTGTTTCAGG No data
1032438446_1032438447 -9 Left 1032438446 7:131921656-131921678 CCTTTTCAGGTAGCTCTTCCTCC No data
Right 1032438447 7:131921670-131921692 TCTTCCTCCCTCTCTGTTTCAGG No data
1032438443_1032438447 14 Left 1032438443 7:131921633-131921655 CCCACGTCACACTGCGGAGGAGA No data
Right 1032438447 7:131921670-131921692 TCTTCCTCCCTCTCTGTTTCAGG No data
1032438438_1032438447 21 Left 1032438438 7:131921626-131921648 CCATTCCCCCACGTCACACTGCG No data
Right 1032438447 7:131921670-131921692 TCTTCCTCCCTCTCTGTTTCAGG No data
1032438441_1032438447 16 Left 1032438441 7:131921631-131921653 CCCCCACGTCACACTGCGGAGGA No data
Right 1032438447 7:131921670-131921692 TCTTCCTCCCTCTCTGTTTCAGG No data
1032438437_1032438447 24 Left 1032438437 7:131921623-131921645 CCTCCATTCCCCCACGTCACACT No data
Right 1032438447 7:131921670-131921692 TCTTCCTCCCTCTCTGTTTCAGG No data
1032438442_1032438447 15 Left 1032438442 7:131921632-131921654 CCCCACGTCACACTGCGGAGGAG No data
Right 1032438447 7:131921670-131921692 TCTTCCTCCCTCTCTGTTTCAGG No data
1032438436_1032438447 27 Left 1032438436 7:131921620-131921642 CCTCCTCCATTCCCCCACGTCAC No data
Right 1032438447 7:131921670-131921692 TCTTCCTCCCTCTCTGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032438447 Original CRISPR TCTTCCTCCCTCTCTGTTTC AGG Intergenic