ID: 1032438448

View in Genome Browser
Species Human (GRCh38)
Location 7:131921674-131921696
Sequence ACTTCCTGAAACAGAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032438448_1032438452 -6 Left 1032438448 7:131921674-131921696 CCTCCCTCTCTGTTTCAGGAAGT No data
Right 1032438452 7:131921691-131921713 GGAAGTATATGTGTCGGAAGAGG No data
1032438448_1032438454 30 Left 1032438448 7:131921674-131921696 CCTCCCTCTCTGTTTCAGGAAGT No data
Right 1032438454 7:131921727-131921749 CACCAGATGGCTCCCGTAAAAGG No data
1032438448_1032438453 17 Left 1032438448 7:131921674-131921696 CCTCCCTCTCTGTTTCAGGAAGT No data
Right 1032438453 7:131921714-131921736 TTGCAAGCGACAACACCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032438448 Original CRISPR ACTTCCTGAAACAGAGAGGG AGG (reversed) Intergenic