ID: 1032438449

View in Genome Browser
Species Human (GRCh38)
Location 7:131921677-131921699
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032438449_1032438454 27 Left 1032438449 7:131921677-131921699 CCCTCTCTGTTTCAGGAAGTATA No data
Right 1032438454 7:131921727-131921749 CACCAGATGGCTCCCGTAAAAGG No data
1032438449_1032438455 28 Left 1032438449 7:131921677-131921699 CCCTCTCTGTTTCAGGAAGTATA No data
Right 1032438455 7:131921728-131921750 ACCAGATGGCTCCCGTAAAAGGG No data
1032438449_1032438457 29 Left 1032438449 7:131921677-131921699 CCCTCTCTGTTTCAGGAAGTATA No data
Right 1032438457 7:131921729-131921751 CCAGATGGCTCCCGTAAAAGGGG No data
1032438449_1032438452 -9 Left 1032438449 7:131921677-131921699 CCCTCTCTGTTTCAGGAAGTATA No data
Right 1032438452 7:131921691-131921713 GGAAGTATATGTGTCGGAAGAGG No data
1032438449_1032438453 14 Left 1032438449 7:131921677-131921699 CCCTCTCTGTTTCAGGAAGTATA No data
Right 1032438453 7:131921714-131921736 TTGCAAGCGACAACACCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032438449 Original CRISPR TATACTTCCTGAAACAGAGA GGG (reversed) Intergenic