ID: 1032438450

View in Genome Browser
Species Human (GRCh38)
Location 7:131921678-131921700
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032438450_1032438452 -10 Left 1032438450 7:131921678-131921700 CCTCTCTGTTTCAGGAAGTATAT 0: 1
1: 0
2: 1
3: 11
4: 191
Right 1032438452 7:131921691-131921713 GGAAGTATATGTGTCGGAAGAGG No data
1032438450_1032438457 28 Left 1032438450 7:131921678-131921700 CCTCTCTGTTTCAGGAAGTATAT 0: 1
1: 0
2: 1
3: 11
4: 191
Right 1032438457 7:131921729-131921751 CCAGATGGCTCCCGTAAAAGGGG No data
1032438450_1032438455 27 Left 1032438450 7:131921678-131921700 CCTCTCTGTTTCAGGAAGTATAT 0: 1
1: 0
2: 1
3: 11
4: 191
Right 1032438455 7:131921728-131921750 ACCAGATGGCTCCCGTAAAAGGG No data
1032438450_1032438454 26 Left 1032438450 7:131921678-131921700 CCTCTCTGTTTCAGGAAGTATAT 0: 1
1: 0
2: 1
3: 11
4: 191
Right 1032438454 7:131921727-131921749 CACCAGATGGCTCCCGTAAAAGG No data
1032438450_1032438453 13 Left 1032438450 7:131921678-131921700 CCTCTCTGTTTCAGGAAGTATAT 0: 1
1: 0
2: 1
3: 11
4: 191
Right 1032438453 7:131921714-131921736 TTGCAAGCGACAACACCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032438450 Original CRISPR ATATACTTCCTGAAACAGAG AGG (reversed) Intergenic