ID: 1032438454

View in Genome Browser
Species Human (GRCh38)
Location 7:131921727-131921749
Sequence CACCAGATGGCTCCCGTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032438448_1032438454 30 Left 1032438448 7:131921674-131921696 CCTCCCTCTCTGTTTCAGGAAGT No data
Right 1032438454 7:131921727-131921749 CACCAGATGGCTCCCGTAAAAGG No data
1032438450_1032438454 26 Left 1032438450 7:131921678-131921700 CCTCTCTGTTTCAGGAAGTATAT No data
Right 1032438454 7:131921727-131921749 CACCAGATGGCTCCCGTAAAAGG No data
1032438449_1032438454 27 Left 1032438449 7:131921677-131921699 CCCTCTCTGTTTCAGGAAGTATA No data
Right 1032438454 7:131921727-131921749 CACCAGATGGCTCCCGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032438454 Original CRISPR CACCAGATGGCTCCCGTAAA AGG Intergenic