ID: 1032438455

View in Genome Browser
Species Human (GRCh38)
Location 7:131921728-131921750
Sequence ACCAGATGGCTCCCGTAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032438449_1032438455 28 Left 1032438449 7:131921677-131921699 CCCTCTCTGTTTCAGGAAGTATA No data
Right 1032438455 7:131921728-131921750 ACCAGATGGCTCCCGTAAAAGGG No data
1032438450_1032438455 27 Left 1032438450 7:131921678-131921700 CCTCTCTGTTTCAGGAAGTATAT No data
Right 1032438455 7:131921728-131921750 ACCAGATGGCTCCCGTAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032438455 Original CRISPR ACCAGATGGCTCCCGTAAAA GGG Intergenic