ID: 1032438455 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:131921728-131921750 |
Sequence | ACCAGATGGCTCCCGTAAAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1032438450_1032438455 | 27 | Left | 1032438450 | 7:131921678-131921700 | CCTCTCTGTTTCAGGAAGTATAT | 0: 1 1: 0 2: 1 3: 11 4: 191 |
||
Right | 1032438455 | 7:131921728-131921750 | ACCAGATGGCTCCCGTAAAAGGG | No data | ||||
1032438449_1032438455 | 28 | Left | 1032438449 | 7:131921677-131921699 | CCCTCTCTGTTTCAGGAAGTATA | No data | ||
Right | 1032438455 | 7:131921728-131921750 | ACCAGATGGCTCCCGTAAAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1032438455 | Original CRISPR | ACCAGATGGCTCCCGTAAAA GGG | Intergenic | ||