ID: 1032440400

View in Genome Browser
Species Human (GRCh38)
Location 7:131938450-131938472
Sequence TCTGGACACAGATGCTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032440400_1032440401 -7 Left 1032440400 7:131938450-131938472 CCATCTGAGCATCTGTGTCCAGA No data
Right 1032440401 7:131938466-131938488 GTCCAGAAGCTCGACCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032440400 Original CRISPR TCTGGACACAGATGCTCAGA TGG (reversed) Intergenic
No off target data available for this crispr