ID: 1032440401

View in Genome Browser
Species Human (GRCh38)
Location 7:131938466-131938488
Sequence GTCCAGAAGCTCGACCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032440398_1032440401 25 Left 1032440398 7:131938418-131938440 CCAAGTCACAAAGATTTTCAATC No data
Right 1032440401 7:131938466-131938488 GTCCAGAAGCTCGACCTGCAAGG No data
1032440399_1032440401 3 Left 1032440399 7:131938440-131938462 CCTTCAAACTCCATCTGAGCATC No data
Right 1032440401 7:131938466-131938488 GTCCAGAAGCTCGACCTGCAAGG No data
1032440396_1032440401 27 Left 1032440396 7:131938416-131938438 CCCCAAGTCACAAAGATTTTCAA No data
Right 1032440401 7:131938466-131938488 GTCCAGAAGCTCGACCTGCAAGG No data
1032440397_1032440401 26 Left 1032440397 7:131938417-131938439 CCCAAGTCACAAAGATTTTCAAT No data
Right 1032440401 7:131938466-131938488 GTCCAGAAGCTCGACCTGCAAGG No data
1032440400_1032440401 -7 Left 1032440400 7:131938450-131938472 CCATCTGAGCATCTGTGTCCAGA No data
Right 1032440401 7:131938466-131938488 GTCCAGAAGCTCGACCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032440401 Original CRISPR GTCCAGAAGCTCGACCTGCA AGG Intergenic
No off target data available for this crispr