ID: 1032443351

View in Genome Browser
Species Human (GRCh38)
Location 7:131959471-131959493
Sequence CAGGATTAACCCACGGAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032443346_1032443351 13 Left 1032443346 7:131959435-131959457 CCTCTCCTCTTGGAATTAATAGT No data
Right 1032443351 7:131959471-131959493 CAGGATTAACCCACGGAATAAGG No data
1032443345_1032443351 14 Left 1032443345 7:131959434-131959456 CCCTCTCCTCTTGGAATTAATAG No data
Right 1032443351 7:131959471-131959493 CAGGATTAACCCACGGAATAAGG No data
1032443347_1032443351 8 Left 1032443347 7:131959440-131959462 CCTCTTGGAATTAATAGTCTCAT No data
Right 1032443351 7:131959471-131959493 CAGGATTAACCCACGGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032443351 Original CRISPR CAGGATTAACCCACGGAATA AGG Intergenic
No off target data available for this crispr