ID: 1032446796

View in Genome Browser
Species Human (GRCh38)
Location 7:131991157-131991179
Sequence GCAAACAGAACGAATCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032446796_1032446801 6 Left 1032446796 7:131991157-131991179 CCAGAGAGATTCGTTCTGTTTGC No data
Right 1032446801 7:131991186-131991208 TAGGTTCACCACAGGGAGGCAGG No data
1032446796_1032446803 18 Left 1032446796 7:131991157-131991179 CCAGAGAGATTCGTTCTGTTTGC No data
Right 1032446803 7:131991198-131991220 AGGGAGGCAGGAATAAAGTAAGG No data
1032446796_1032446799 -1 Left 1032446796 7:131991157-131991179 CCAGAGAGATTCGTTCTGTTTGC No data
Right 1032446799 7:131991179-131991201 CTCTTCATAGGTTCACCACAGGG No data
1032446796_1032446800 2 Left 1032446796 7:131991157-131991179 CCAGAGAGATTCGTTCTGTTTGC No data
Right 1032446800 7:131991182-131991204 TTCATAGGTTCACCACAGGGAGG No data
1032446796_1032446804 21 Left 1032446796 7:131991157-131991179 CCAGAGAGATTCGTTCTGTTTGC No data
Right 1032446804 7:131991201-131991223 GAGGCAGGAATAAAGTAAGGAGG No data
1032446796_1032446798 -2 Left 1032446796 7:131991157-131991179 CCAGAGAGATTCGTTCTGTTTGC No data
Right 1032446798 7:131991178-131991200 GCTCTTCATAGGTTCACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032446796 Original CRISPR GCAAACAGAACGAATCTCTC TGG (reversed) Intergenic
No off target data available for this crispr