ID: 1032446801

View in Genome Browser
Species Human (GRCh38)
Location 7:131991186-131991208
Sequence TAGGTTCACCACAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032446796_1032446801 6 Left 1032446796 7:131991157-131991179 CCAGAGAGATTCGTTCTGTTTGC No data
Right 1032446801 7:131991186-131991208 TAGGTTCACCACAGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032446801 Original CRISPR TAGGTTCACCACAGGGAGGC AGG Intergenic
No off target data available for this crispr