ID: 1032447557

View in Genome Browser
Species Human (GRCh38)
Location 7:131997660-131997682
Sequence GAGCAAACAGGAGTGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032447557_1032447564 19 Left 1032447557 7:131997660-131997682 CCATCCATCACTCCTGTTTGCTC No data
Right 1032447564 7:131997702-131997724 TTATTCCTGCTTCTGCCCTAGGG No data
1032447557_1032447563 18 Left 1032447557 7:131997660-131997682 CCATCCATCACTCCTGTTTGCTC No data
Right 1032447563 7:131997701-131997723 GTTATTCCTGCTTCTGCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032447557 Original CRISPR GAGCAAACAGGAGTGATGGA TGG (reversed) Intergenic
No off target data available for this crispr