ID: 1032448383

View in Genome Browser
Species Human (GRCh38)
Location 7:132004176-132004198
Sequence ACTCCTGGTGAGTCCTTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032448382_1032448383 -10 Left 1032448382 7:132004163-132004185 CCTGGAGAAGGAAACTCCTGGTG No data
Right 1032448383 7:132004176-132004198 ACTCCTGGTGAGTCCTTCTTTGG No data
1032448378_1032448383 9 Left 1032448378 7:132004144-132004166 CCTGTCAAACTGGCTGGAACCTG No data
Right 1032448383 7:132004176-132004198 ACTCCTGGTGAGTCCTTCTTTGG No data
1032448377_1032448383 13 Left 1032448377 7:132004140-132004162 CCTACCTGTCAAACTGGCTGGAA No data
Right 1032448383 7:132004176-132004198 ACTCCTGGTGAGTCCTTCTTTGG No data
1032448374_1032448383 23 Left 1032448374 7:132004130-132004152 CCATGGAGAGCCTACCTGTCAAA No data
Right 1032448383 7:132004176-132004198 ACTCCTGGTGAGTCCTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032448383 Original CRISPR ACTCCTGGTGAGTCCTTCTT TGG Intergenic