ID: 1032450646

View in Genome Browser
Species Human (GRCh38)
Location 7:132027608-132027630
Sequence AATAACCCATTCAATAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032450646_1032450651 -9 Left 1032450646 7:132027608-132027630 CCTGCTTTATTGAATGGGTTATT No data
Right 1032450651 7:132027622-132027644 TGGGTTATTAAAGGTGGGTTGGG No data
1032450646_1032450652 18 Left 1032450646 7:132027608-132027630 CCTGCTTTATTGAATGGGTTATT No data
Right 1032450652 7:132027649-132027671 TTACCTATTTCCCCCTCCCATGG No data
1032450646_1032450650 -10 Left 1032450646 7:132027608-132027630 CCTGCTTTATTGAATGGGTTATT No data
Right 1032450650 7:132027621-132027643 ATGGGTTATTAAAGGTGGGTTGG No data
1032450646_1032450654 25 Left 1032450646 7:132027608-132027630 CCTGCTTTATTGAATGGGTTATT No data
Right 1032450654 7:132027656-132027678 TTTCCCCCTCCCATGGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032450646 Original CRISPR AATAACCCATTCAATAAAGC AGG (reversed) Intergenic
No off target data available for this crispr