ID: 1032450651

View in Genome Browser
Species Human (GRCh38)
Location 7:132027622-132027644
Sequence TGGGTTATTAAAGGTGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032450645_1032450651 -5 Left 1032450645 7:132027604-132027626 CCTTCCTGCTTTATTGAATGGGT No data
Right 1032450651 7:132027622-132027644 TGGGTTATTAAAGGTGGGTTGGG No data
1032450646_1032450651 -9 Left 1032450646 7:132027608-132027630 CCTGCTTTATTGAATGGGTTATT No data
Right 1032450651 7:132027622-132027644 TGGGTTATTAAAGGTGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032450651 Original CRISPR TGGGTTATTAAAGGTGGGTT GGG Intergenic
No off target data available for this crispr