ID: 1032452229

View in Genome Browser
Species Human (GRCh38)
Location 7:132042906-132042928
Sequence GTGGGGAAACAGTGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032452219_1032452229 18 Left 1032452219 7:132042865-132042887 CCTTGGAGCTTGCTTGGGCATTA No data
Right 1032452229 7:132042906-132042928 GTGGGGAAACAGTGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032452229 Original CRISPR GTGGGGAAACAGTGGGAGGC AGG Intergenic
No off target data available for this crispr