ID: 1032453095

View in Genome Browser
Species Human (GRCh38)
Location 7:132051592-132051614
Sequence TGGTGGGAATGAAGGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032453095_1032453103 8 Left 1032453095 7:132051592-132051614 CCTATTTCCCTTCATTCCCACCA No data
Right 1032453103 7:132051623-132051645 CCAGGCTCCATTCTTGCCAAAGG No data
1032453095_1032453098 -10 Left 1032453095 7:132051592-132051614 CCTATTTCCCTTCATTCCCACCA No data
Right 1032453098 7:132051605-132051627 ATTCCCACCATTATTCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032453095 Original CRISPR TGGTGGGAATGAAGGGAAAT AGG (reversed) Intergenic
No off target data available for this crispr