ID: 1032454207

View in Genome Browser
Species Human (GRCh38)
Location 7:132059540-132059562
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032454203_1032454207 8 Left 1032454203 7:132059509-132059531 CCTTGAGTGTCATAGGACACTCG No data
Right 1032454207 7:132059540-132059562 GACTTGCACCCTGAGTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032454207 Original CRISPR GACTTGCACCCTGAGTGTTG TGG Intergenic
No off target data available for this crispr