ID: 1032454568

View in Genome Browser
Species Human (GRCh38)
Location 7:132063730-132063752
Sequence TTTGCAAGACAGATGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032454563_1032454568 6 Left 1032454563 7:132063701-132063723 CCTTGTCCTCTGTAAAATCCATT No data
Right 1032454568 7:132063730-132063752 TTTGCAAGACAGATGGAAAAAGG No data
1032454562_1032454568 10 Left 1032454562 7:132063697-132063719 CCTTCCTTGTCCTCTGTAAAATC No data
Right 1032454568 7:132063730-132063752 TTTGCAAGACAGATGGAAAAAGG No data
1032454564_1032454568 0 Left 1032454564 7:132063707-132063729 CCTCTGTAAAATCCATTCACACC No data
Right 1032454568 7:132063730-132063752 TTTGCAAGACAGATGGAAAAAGG No data
1032454561_1032454568 21 Left 1032454561 7:132063686-132063708 CCTTTTTCTCTCCTTCCTTGTCC No data
Right 1032454568 7:132063730-132063752 TTTGCAAGACAGATGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032454568 Original CRISPR TTTGCAAGACAGATGGAAAA AGG Intergenic
No off target data available for this crispr